Incidental Mutation 'R7764:Cxxc4'
ID598106
Institutional Source Beutler Lab
Gene Symbol Cxxc4
Ensembl Gene ENSMUSG00000044365
Gene NameCXXC finger 4
Synonyms9330210J02Rik, C030003J12Rik, Idax
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score149.008
Status Not validated
Chromosome3
Chromosomal Location134236484-134262161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 134240095 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 146 (G146C)
Ref Sequence ENSEMBL: ENSMUSP00000138000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166288] [ENSMUST00000181904]
Predicted Effect probably benign
Transcript: ENSMUST00000166288
SMART Domains Protein: ENSMUSP00000128574
Gene: ENSMUSG00000044365

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Pfam:zf-CXXC 131 172 5.1e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181904
AA Change: G146C
SMART Domains Protein: ENSMUSP00000138000
Gene: ENSMUSG00000044365
AA Change: G146C

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 165 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Pfam:zf-CXXC 299 340 5.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Cxxc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cxxc4 APN 3 134240659 missense probably null 0.99
R1839:Cxxc4 UTSW 3 134240653 missense probably damaging 1.00
R6265:Cxxc4 UTSW 3 134258063 missense probably benign 0.02
R6744:Cxxc4 UTSW 3 134240130 small insertion probably benign
R6947:Cxxc4 UTSW 3 134240516 missense possibly damaging 0.90
R7842:Cxxc4 UTSW 3 134240332 missense possibly damaging 0.93
R7860:Cxxc4 UTSW 3 134258053 missense probably benign 0.21
Z1177:Cxxc4 UTSW 3 134240050 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCTACAAGACCAACGGGG -3'
(R):5'- CAAAGGTCTGCAGTGTTCGG -3'

Sequencing Primer
(F):5'- CATGTCCCCGTGGAACTG -3'
(R):5'- CTGCAGTGTTCGGGGGATAAG -3'
Posted On2019-11-26