Incidental Mutation 'R7764:Poln'
ID598113
Institutional Source Beutler Lab
Gene Symbol Poln
Ensembl Gene ENSMUSG00000045102
Gene NameDNA polymerase N
SynonymsPOL4P
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34007179-34169448 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34116807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000202409] [ENSMUST00000202638]
Predicted Effect probably null
Transcript: ENSMUST00000042954
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202409
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202638
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced meiotic double-strand breaks at a meiotic recombination hot spot harboring insertion/deletion polymorphisms, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Poln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Poln APN 5 34122760 missense probably benign 0.17
IGL00938:Poln APN 5 34129224 missense probably damaging 1.00
IGL02081:Poln APN 5 34129139 missense probably benign
IGL02411:Poln APN 5 34113322 nonsense probably null
IGL02440:Poln APN 5 34129130 missense probably damaging 1.00
IGL02484:Poln APN 5 34129377 missense probably damaging 1.00
IGL02577:Poln APN 5 34113335 missense probably benign 0.03
IGL03113:Poln APN 5 34116862 missense probably benign 0.01
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0068:Poln UTSW 5 34077088 splice site probably benign
R0068:Poln UTSW 5 34077088 splice site probably benign
R0325:Poln UTSW 5 34149764 missense probably benign 0.00
R0578:Poln UTSW 5 34014338 missense probably damaging 1.00
R0631:Poln UTSW 5 34118958 missense possibly damaging 0.93
R1171:Poln UTSW 5 34103940 missense probably damaging 1.00
R1266:Poln UTSW 5 34133109 critical splice donor site probably null
R1418:Poln UTSW 5 34078975 missense probably benign 0.00
R1449:Poln UTSW 5 34014338 missense probably damaging 1.00
R1558:Poln UTSW 5 34032799 missense probably benign 0.04
R1723:Poln UTSW 5 34122672 missense probably benign 0.16
R1806:Poln UTSW 5 34107150 splice site probably benign
R4124:Poln UTSW 5 34103951 missense probably benign 0.32
R4125:Poln UTSW 5 34103951 missense probably benign 0.32
R4128:Poln UTSW 5 34103951 missense probably benign 0.32
R4155:Poln UTSW 5 34009649 missense possibly damaging 0.90
R4353:Poln UTSW 5 34129452 missense probably benign 0.00
R4717:Poln UTSW 5 34129448 missense possibly damaging 0.46
R4788:Poln UTSW 5 34129331 missense probably benign 0.30
R4981:Poln UTSW 5 34107085 critical splice donor site probably null
R5456:Poln UTSW 5 34007442 missense possibly damaging 0.95
R6020:Poln UTSW 5 34109431 missense probably damaging 0.99
R6484:Poln UTSW 5 34129513 missense probably benign 0.01
R7134:Poln UTSW 5 34118996 missense possibly damaging 0.86
R7639:Poln UTSW 5 34133151 missense possibly damaging 0.77
R7874:Poln UTSW 5 34024350 missense probably damaging 1.00
R7957:Poln UTSW 5 34024350 missense probably damaging 1.00
R8039:Poln UTSW 5 34122672 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAGACATGCCTGGAAATCTCTC -3'
(R):5'- GGGAAACAATTGCCTGTAACTTG -3'

Sequencing Primer
(F):5'- GCCTGGAAATCTCTCATCTTTATTC -3'
(R):5'- TGCCTGTAACTTGAATGAATGC -3'
Posted On2019-11-26