Incidental Mutation 'R7764:Myl10'
ID 598117
Institutional Source Beutler Lab
Gene Symbol Myl10
Ensembl Gene ENSMUSG00000005474
Gene Name myosin, light chain 10, regulatory
Synonyms PLRLC-C, 1700027I08Rik, PLRLC, PLRLC-A, Mylc2pl, PLRLC-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7764 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 136693146-136701094 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 136697971 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 70 (V70L)
Ref Sequence ENSEMBL: ENSMUSP00000143165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005611] [ENSMUST00000196068] [ENSMUST00000196436] [ENSMUST00000197186]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005611
AA Change: V86L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005611
Gene: ENSMUSG00000005474
AA Change: V86L

DomainStartEndE-ValueType
EFh 9 37 1.5e-5 SMART
EFh 79 107 3.16e1 SMART
Blast:EFh 115 143 6e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196068
AA Change: K115N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142570
Gene: ENSMUSG00000005474
AA Change: K115N

DomainStartEndE-ValueType
Pfam:EF-hand_1 9 37 9.4e-7 PFAM
Pfam:EF-hand_6 9 40 9.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196436
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142495
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197186
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143165
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199074
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Kif5c T C 2: 49,727,961 probably null Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Myl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Myl10 APN 5 136697942 nonsense probably null
G1Funyon:Myl10 UTSW 5 136697971 missense probably benign 0.00
PIT4243001:Myl10 UTSW 5 136694293 missense probably benign 0.05
R4066:Myl10 UTSW 5 136695450 missense probably damaging 1.00
R5712:Myl10 UTSW 5 136694238 missense probably damaging 1.00
R6321:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6322:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6566:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6756:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6757:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6894:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7033:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7152:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7242:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7411:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7484:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7535:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7537:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7630:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7631:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7635:Myl10 UTSW 5 136700864 missense probably benign 0.00
R7829:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7969:Myl10 UTSW 5 136700853 critical splice acceptor site probably null
R8065:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8066:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8067:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8202:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8203:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8204:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8206:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8217:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8248:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8300:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8301:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8343:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8731:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8732:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8831:Myl10 UTSW 5 136697971 missense probably benign 0.00
R9324:Myl10 UTSW 5 136700933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCAGCTGGAGTAGTTC -3'
(R):5'- TATACCAGGAGGAACGGCTG -3'

Sequencing Primer
(F):5'- CTGCCTAGAATCTTCCAGTGAGG -3'
(R):5'- CAGGAGGAACGGCTGGTTTG -3'
Posted On 2019-11-26