Incidental Mutation 'R7764:Frmd4b'
ID598119
Institutional Source Beutler Lab
Gene Symbol Frmd4b
Ensembl Gene ENSMUSG00000030064
Gene NameFERM domain containing 4B
Synonyms6030440G05Rik, GRSP1
Accession Numbers

Ncbi RefSeq: NM_145148.2; MGI:2141794

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location97286867-97617541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97295930 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 834 (Y834H)
Ref Sequence ENSEMBL: ENSMUSP00000032146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032146] [ENSMUST00000113355] [ENSMUST00000113359]
Predicted Effect probably damaging
Transcript: ENSMUST00000032146
AA Change: Y834H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064
AA Change: Y834H

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113355
AA Change: Y780H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064
AA Change: Y780H

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113359
AA Change: Y788H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064
AA Change: Y788H

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GRP1-binding protein which contains a FERM protein interaction domain as well as two coiled coil domains. This protein may play a role as a scaffolding protein. [provided by RefSeq, Mar 2014]
Allele List at MGI

All alleles(24) : Targeted(2) Gene trapped(22)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Frmd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Frmd4b APN 6 97308060 missense probably damaging 1.00
IGL01478:Frmd4b APN 6 97328293 missense probably damaging 1.00
IGL01760:Frmd4b APN 6 97308702 missense probably damaging 1.00
IGL01777:Frmd4b APN 6 97295944 missense probably benign 0.03
IGL01960:Frmd4b APN 6 97295780 missense possibly damaging 0.93
IGL02408:Frmd4b APN 6 97295809 missense probably damaging 1.00
IGL02429:Frmd4b APN 6 97325429 splice site probably benign
IGL02525:Frmd4b APN 6 97412533 missense probably damaging 1.00
IGL02618:Frmd4b APN 6 97308105 nonsense probably null
IGL03051:Frmd4b APN 6 97295982 nonsense probably null
IGL03120:Frmd4b APN 6 97396245 missense possibly damaging 0.88
IGL03218:Frmd4b APN 6 97308114 missense probably benign 0.01
IGL03260:Frmd4b APN 6 97396224 missense probably damaging 1.00
IGL02984:Frmd4b UTSW 6 97296260 missense probably damaging 0.96
P0031:Frmd4b UTSW 6 97354030 missense probably damaging 1.00
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0058:Frmd4b UTSW 6 97423499 missense probably damaging 1.00
R0255:Frmd4b UTSW 6 97308086 missense probably damaging 1.00
R0437:Frmd4b UTSW 6 97423463 missense probably damaging 1.00
R0594:Frmd4b UTSW 6 97325426 splice site probably benign
R1525:Frmd4b UTSW 6 97296386 missense probably damaging 0.97
R1640:Frmd4b UTSW 6 97308673 missense possibly damaging 0.91
R1768:Frmd4b UTSW 6 97306764 missense possibly damaging 0.68
R1923:Frmd4b UTSW 6 97288454 missense probably benign 0.33
R2056:Frmd4b UTSW 6 97412487 critical splice donor site probably null
R2192:Frmd4b UTSW 6 97487616 missense probably damaging 0.98
R3809:Frmd4b UTSW 6 97323729 missense possibly damaging 0.49
R3831:Frmd4b UTSW 6 97412525 nonsense probably null
R4466:Frmd4b UTSW 6 97323653 critical splice donor site probably null
R4536:Frmd4b UTSW 6 97310732 missense possibly damaging 0.57
R4652:Frmd4b UTSW 6 97295755 missense probably benign 0.38
R4679:Frmd4b UTSW 6 97295666 missense possibly damaging 0.94
R4735:Frmd4b UTSW 6 97459259 start gained probably benign
R4793:Frmd4b UTSW 6 97295861 missense probably damaging 0.99
R4940:Frmd4b UTSW 6 97298090 missense probably damaging 1.00
R4948:Frmd4b UTSW 6 97306730 missense probably benign 0.06
R5092:Frmd4b UTSW 6 97295980 missense probably damaging 0.98
R5119:Frmd4b UTSW 6 97300314 missense probably benign 0.03
R5289:Frmd4b UTSW 6 97302348 splice site probably null
R5610:Frmd4b UTSW 6 97306791 missense probably benign
R5690:Frmd4b UTSW 6 97353203 missense possibly damaging 0.56
R6248:Frmd4b UTSW 6 97459212 missense probably benign 0.10
R6437:Frmd4b UTSW 6 97296267 missense probably damaging 1.00
R6459:Frmd4b UTSW 6 97487640 missense probably damaging 1.00
R6825:Frmd4b UTSW 6 97325476 missense possibly damaging 0.89
R6964:Frmd4b UTSW 6 97305197 missense probably damaging 1.00
R7110:Frmd4b UTSW 6 97296231 nonsense probably null
R7154:Frmd4b UTSW 6 97306746 missense probably damaging 1.00
R8073:Frmd4b UTSW 6 97306713 missense probably benign 0.03
X0020:Frmd4b UTSW 6 97305365 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGATCCTTTTGTCCAGAAGCC -3'
(R):5'- AGGAAGCATGCCCAACCTAG -3'

Sequencing Primer
(F):5'- TCAGCAACTAAGGCCTTGTG -3'
(R):5'- CCTAGCACAAAAGGATCCTTTGAGG -3'
Posted On2019-11-26