Incidental Mutation 'R7764:Rasgrf1'
ID598128
Institutional Source Beutler Lab
Gene Symbol Rasgrf1
Ensembl Gene ENSMUSG00000032356
Gene NameRAS protein-specific guanine nucleotide-releasing factor 1
SynonymsCDC25, Grfbeta, CDC25Mm, Grf1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location89909908-90026977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89994694 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 704 (S704I)
Ref Sequence ENSEMBL: ENSMUSP00000034912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034912]
PDB Structure
Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034912
AA Change: S704I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: S704I

DomainStartEndE-ValueType
PH 23 132 2.48e-18 SMART
Blast:RhoGEF 146 196 4e-6 BLAST
IQ 205 227 5.27e0 SMART
RhoGEF 248 429 1.96e-57 SMART
PH 461 590 1.51e-8 SMART
RasGEFN 634 767 3.07e-10 SMART
low complexity region 844 855 N/A INTRINSIC
RasGEFN 869 997 5.86e-7 SMART
RasGEF 1023 1260 1.85e-99 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Rasgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Rasgrf1 APN 9 89970481 missense probably damaging 1.00
IGL00763:Rasgrf1 APN 9 89971020 missense probably benign 0.05
IGL01336:Rasgrf1 APN 9 89991530 missense probably benign 0.00
IGL01710:Rasgrf1 APN 9 89991692 missense probably benign 0.18
IGL01807:Rasgrf1 APN 9 89991513 missense probably damaging 0.99
IGL01939:Rasgrf1 APN 9 89974836 missense probably damaging 0.99
IGL02453:Rasgrf1 APN 9 89944760 missense possibly damaging 0.76
IGL02961:Rasgrf1 APN 9 89981649 missense possibly damaging 0.88
IGL03009:Rasgrf1 APN 9 89991703 missense possibly damaging 0.75
IGL03369:Rasgrf1 APN 9 90010451 missense probably damaging 1.00
IGL03373:Rasgrf1 APN 9 90017031 splice site probably benign
Malenkiy UTSW 9 90010484 splice site probably null
PIT4142001:Rasgrf1 UTSW 9 89915573 missense possibly damaging 0.91
R0234:Rasgrf1 UTSW 9 90009366 missense probably damaging 1.00
R0629:Rasgrf1 UTSW 9 89984269 missense probably damaging 1.00
R0685:Rasgrf1 UTSW 9 89915482 utr 3 prime probably benign
R0730:Rasgrf1 UTSW 9 89951009 splice site probably benign
R0835:Rasgrf1 UTSW 9 90000771 missense probably benign
R1432:Rasgrf1 UTSW 9 90012800 missense probably benign 0.35
R1647:Rasgrf1 UTSW 9 89953920 missense probably benign 0.28
R1717:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1933:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1934:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R2187:Rasgrf1 UTSW 9 89994835 missense possibly damaging 0.93
R2240:Rasgrf1 UTSW 9 89976762 missense probably damaging 0.99
R2940:Rasgrf1 UTSW 9 89991714 missense possibly damaging 0.84
R3949:Rasgrf1 UTSW 9 89981744 splice site probably benign
R4751:Rasgrf1 UTSW 9 89910118 missense probably damaging 1.00
R4751:Rasgrf1 UTSW 9 90012866 missense probably damaging 1.00
R4901:Rasgrf1 UTSW 9 89995003 missense probably benign 0.00
R4910:Rasgrf1 UTSW 9 89976752 missense probably benign 0.00
R4961:Rasgrf1 UTSW 9 89944869 missense probably benign 0.06
R5270:Rasgrf1 UTSW 9 90026694 missense probably benign 0.00
R5320:Rasgrf1 UTSW 9 90020425 missense probably damaging 0.99
R5602:Rasgrf1 UTSW 9 89911571 missense possibly damaging 0.73
R5659:Rasgrf1 UTSW 9 89984289 missense probably damaging 1.00
R5960:Rasgrf1 UTSW 9 90021384 missense possibly damaging 0.69
R6074:Rasgrf1 UTSW 9 89953915 missense probably benign 0.01
R6400:Rasgrf1 UTSW 9 89991630 missense probably damaging 1.00
R6596:Rasgrf1 UTSW 9 90012794 missense possibly damaging 0.92
R6603:Rasgrf1 UTSW 9 89910257 missense probably damaging 0.96
R6647:Rasgrf1 UTSW 9 90010463 missense probably benign 0.00
R6813:Rasgrf1 UTSW 9 90010484 splice site probably null
R7136:Rasgrf1 UTSW 9 89991598 missense probably damaging 1.00
R7155:Rasgrf1 UTSW 9 90002361 missense possibly damaging 0.90
R7175:Rasgrf1 UTSW 9 89980749 missense probably benign 0.02
R7202:Rasgrf1 UTSW 9 90017072 missense possibly damaging 0.49
R7219:Rasgrf1 UTSW 9 89984288 missense probably damaging 1.00
R7244:Rasgrf1 UTSW 9 89994757 missense probably damaging 1.00
R7733:Rasgrf1 UTSW 9 89981727 missense probably benign 0.01
R8210:Rasgrf1 UTSW 9 89911622 missense unknown
Z1177:Rasgrf1 UTSW 9 89950917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGATAGACATTGGTCCC -3'
(R):5'- CCAGTGTGGTTTTGCCGAAG -3'

Sequencing Primer
(F):5'- TGGTCCCCAAATCCTTTAATCAC -3'
(R):5'- TATCGGAGCTGCACCCAAG -3'
Posted On2019-11-26