Incidental Mutation 'R7764:Zic1'
ID598129
Institutional Source Beutler Lab
Gene Symbol Zic1
Ensembl Gene ENSMUSG00000032368
Gene Namezinc finger protein of the cerebellum 1
Synonymsodd-paired homolog
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R7764 (G1)
Quality Score165.009
Status Not validated
Chromosome9
Chromosomal Location91358058-91365810 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 91365692 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034927] [ENSMUST00000065360] [ENSMUST00000172646] [ENSMUST00000173054] [ENSMUST00000173342]
Predicted Effect probably benign
Transcript: ENSMUST00000034927
SMART Domains Protein: ENSMUSP00000034927
Gene: ENSMUSG00000032368

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065360
SMART Domains Protein: ENSMUSP00000068858
Gene: ENSMUSG00000032368

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172646
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173054
SMART Domains Protein: ENSMUSP00000134364
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
PDB:2EJ4|A 122 181 3e-16 PDB
Blast:ZnF_C2H2 128 151 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173342
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show cerebellar hypoplasia with a missing lobule of the anterior lobe. Newborn pups suckle poorly. 50% die within one day of birth and almost all die within 3 weeks; longer survivors show marked ataxia and exhibit tonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Zic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Zic1 APN 9 91362472 utr 5 prime probably null
IGL02669:Zic1 APN 9 91364433 missense possibly damaging 0.71
IGL02968:Zic1 APN 9 91362490 missense probably damaging 1.00
PIT4812001:Zic1 UTSW 9 91364341 missense probably damaging 1.00
R1493:Zic1 UTSW 9 91364756 missense probably damaging 1.00
R1599:Zic1 UTSW 9 91361688 missense probably benign 0.08
R1742:Zic1 UTSW 9 91361576 missense probably damaging 0.98
R2158:Zic1 UTSW 9 91364893 missense possibly damaging 0.73
R4587:Zic1 UTSW 9 91364822 missense probably damaging 1.00
R4735:Zic1 UTSW 9 91364505 missense possibly damaging 0.55
R4830:Zic1 UTSW 9 91362531 missense probably damaging 1.00
R5186:Zic1 UTSW 9 91364371 missense probably damaging 1.00
R5702:Zic1 UTSW 9 91364080 missense probably damaging 0.99
R6298:Zic1 UTSW 9 91364503 missense probably damaging 1.00
R7221:Zic1 UTSW 9 91364732 missense probably damaging 1.00
R7250:Zic1 UTSW 9 91364975 missense probably damaging 0.99
R7806:Zic1 UTSW 9 91364971 missense probably damaging 1.00
RF011:Zic1 UTSW 9 91364330 missense probably benign 0.00
Z1177:Zic1 UTSW 9 91364579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGGATTTGTGGCATAGAG -3'
(R):5'- TACCTGGGATTGATGAGGCG -3'

Sequencing Primer
(F):5'- ATGTGAACGCCAGAGCC -3'
(R):5'- TTGCTGCTATCAGTCTCG -3'
Posted On2019-11-26