Incidental Mutation 'R7764:Ccdc162'
ID598132
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41690113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 78 (V78D)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000189488] [ENSMUST00000190522]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189488
AA Change: V78D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: V78D

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190522
AA Change: V78D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140852
Gene: ENSMUSG00000100855
AA Change: V78D

DomainStartEndE-ValueType
Pfam:DUF4549 2 145 7.9e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190522
AA Change: V78D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
R7712:Ccdc162 UTSW 10 41627227 missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41553075 missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41587375 missense probably damaging 1.00
R8053:Ccdc162 UTSW 10 41644581 missense probably benign
R8088:Ccdc162 UTSW 10 41623414 missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41612868 missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41634119 missense probably benign 0.03
Z1176:Ccdc162 UTSW 10 41553131 missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41605108 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41654997 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41690092 missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41683195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACCCATCTCCAGAACACTTG -3'
(R):5'- AGTTCGCAGGAAAAGCTCCC -3'

Sequencing Primer
(F):5'- TTGCCCACAGGAGCTACC -3'
(R):5'- GGCAAACAGCTGATACTTTTGAAC -3'
Posted On2019-11-26