Incidental Mutation 'R7764:Slc38a10'
ID598137
Institutional Source Beutler Lab
Gene Symbol Slc38a10
Ensembl Gene ENSMUSG00000061306
Gene Namesolute carrier family 38, member 10
Synonyms1810073N04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120103960-120151346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120105079 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1064 (L1064P)
Ref Sequence ENSEMBL: ENSMUSP00000099307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045402] [ENSMUST00000103018] [ENSMUST00000106223] [ENSMUST00000179094] [ENSMUST00000185558]
Predicted Effect probably damaging
Transcript: ENSMUST00000045402
AA Change: L1056P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048675
Gene: ENSMUSG00000061306
AA Change: L1056P

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1.5e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 699 735 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 1011 1019 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103018
AA Change: L1064P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099307
Gene: ENSMUSG00000061306
AA Change: L1064P

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 8.5e-55 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106223
Predicted Effect probably damaging
Transcript: ENSMUST00000179094
AA Change: L1064P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136719
Gene: ENSMUSG00000061306
AA Change: L1064P

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185558
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit a fragile skeleton, reduced adiposity, lean body mass, body weight/length, long bone length and bone mineral density, increased creatinine levels, reduced amylase and serum albumin levels, increased energy efficiency and oxygen consumption, and altered liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rab15 A C 12: 76,804,441 probably null Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Slc38a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Slc38a10 APN 11 120138988 missense probably damaging 1.00
IGL00236:Slc38a10 APN 11 120106602 missense probably damaging 0.96
IGL01420:Slc38a10 APN 11 120106460 missense probably damaging 0.99
IGL01704:Slc38a10 APN 11 120151087 utr 5 prime probably benign
IGL01747:Slc38a10 APN 11 120134774 splice site probably benign
IGL02295:Slc38a10 APN 11 120116858 splice site probably benign
IGL02300:Slc38a10 APN 11 120110290 missense probably benign 0.00
IGL02429:Slc38a10 APN 11 120134888 splice site probably benign
IGL03155:Slc38a10 APN 11 120105119 missense probably damaging 0.96
IGL03396:Slc38a10 APN 11 120128475 missense probably damaging 1.00
Cascade UTSW 11 120147819 missense probably damaging 1.00
cherries UTSW 11 120151077 start codon destroyed probably null 1.00
Ore UTSW 11 120134853 missense probably damaging 1.00
rainier UTSW 11 120129312 nonsense probably null
slag UTSW 11 120132741 missense probably damaging 1.00
R0048:Slc38a10 UTSW 11 120110312 missense probably benign 0.11
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0069:Slc38a10 UTSW 11 120106502 missense probably damaging 1.00
R0101:Slc38a10 UTSW 11 120151077 start codon destroyed probably null 1.00
R0743:Slc38a10 UTSW 11 120140643 missense probably damaging 1.00
R1159:Slc38a10 UTSW 11 120105475 missense probably benign
R2101:Slc38a10 UTSW 11 120132741 missense probably damaging 1.00
R2367:Slc38a10 UTSW 11 120110261 missense probably benign 0.12
R4280:Slc38a10 UTSW 11 120137878 missense probably damaging 1.00
R4282:Slc38a10 UTSW 11 120129264 missense probably damaging 1.00
R5206:Slc38a10 UTSW 11 120105062 missense probably damaging 0.99
R5658:Slc38a10 UTSW 11 120105392 missense probably benign 0.11
R6114:Slc38a10 UTSW 11 120129312 nonsense probably null
R6118:Slc38a10 UTSW 11 120132843 missense probably damaging 1.00
R6306:Slc38a10 UTSW 11 120147819 missense probably damaging 1.00
R6395:Slc38a10 UTSW 11 120124382 missense probably benign 0.01
R6428:Slc38a10 UTSW 11 120105472 missense probably benign 0.09
R7835:Slc38a10 UTSW 11 120116996 missense possibly damaging 0.95
X0062:Slc38a10 UTSW 11 120116900 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGAACGTGGCCTCCAATCAG -3'
(R):5'- ACCAGATCCTAACTCTGGGC -3'

Sequencing Primer
(F):5'- TCCAATCAGGGTGGCACCAG -3'
(R):5'- AAACTAGCTGTGCCTGCG -3'
Posted On2019-11-26