Incidental Mutation 'R7764:Rab15'
ID598138
Institutional Source Beutler Lab
Gene Symbol Rab15
Ensembl Gene ENSMUSG00000021062
Gene NameRAB15, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7764 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location76797960-76822908 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 76804441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021459] [ENSMUST00000021459] [ENSMUST00000118604] [ENSMUST00000118604] [ENSMUST00000121716] [ENSMUST00000121716] [ENSMUST00000122419] [ENSMUST00000122419] [ENSMUST00000125842] [ENSMUST00000137826] [ENSMUST00000141622] [ENSMUST00000141622] [ENSMUST00000154765] [ENSMUST00000154765]
Predicted Effect probably null
Transcript: ENSMUST00000021459
SMART Domains Protein: ENSMUSP00000021459
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 9 172 2.04e-102 SMART
low complexity region 187 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021459
SMART Domains Protein: ENSMUSP00000021459
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 9 172 2.04e-102 SMART
low complexity region 187 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118604
SMART Domains Protein: ENSMUSP00000112789
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 1 126 1.21e-54 SMART
low complexity region 141 151 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118604
SMART Domains Protein: ENSMUSP00000112789
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 1 126 1.21e-54 SMART
low complexity region 141 151 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121716
SMART Domains Protein: ENSMUSP00000113299
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 1 126 1.21e-54 SMART
low complexity region 141 151 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121716
SMART Domains Protein: ENSMUSP00000113299
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 1 126 1.21e-54 SMART
low complexity region 141 151 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122419
SMART Domains Protein: ENSMUSP00000112457
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 14 143 3.04e-60 SMART
low complexity region 158 168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122419
SMART Domains Protein: ENSMUSP00000112457
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 14 143 3.04e-60 SMART
low complexity region 158 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125842
SMART Domains Protein: ENSMUSP00000116906
Gene: ENSMUSG00000033373

DomainStartEndE-ValueType
Pfam:Churchill 1 65 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137826
SMART Domains Protein: ENSMUSP00000120713
Gene: ENSMUSG00000033373

DomainStartEndE-ValueType
Pfam:Churchill 1 92 1.9e-42 PFAM
Pfam:Prenyltrans 157 198 5.1e-16 PFAM
Pfam:Prenyltrans 206 249 2.8e-13 PFAM
Pfam:Prenyltrans 255 297 1e-14 PFAM
Pfam:Prenyltrans 302 346 1.6e-12 PFAM
Pfam:Prenyltrans 364 408 1.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141622
SMART Domains Protein: ENSMUSP00000115720
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
Pfam:Miro 1 78 1.4e-11 PFAM
Pfam:Arf 1 113 6.9e-7 PFAM
Pfam:Ras 1 114 3.1e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141622
SMART Domains Protein: ENSMUSP00000115720
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
Pfam:Miro 1 78 1.4e-11 PFAM
Pfam:Arf 1 113 6.9e-7 PFAM
Pfam:Ras 1 114 3.1e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154765
SMART Domains Protein: ENSMUSP00000122067
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 1 126 1.21e-54 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154765
SMART Domains Protein: ENSMUSP00000122067
Gene: ENSMUSG00000021062

DomainStartEndE-ValueType
RAB 1 126 1.21e-54 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,290 L93V probably benign Het
Adss A C 1: 177,764,261 M452R probably damaging Het
Aldh3b1 T A 19: 3,921,563 K102* probably null Het
Ccdc162 A T 10: 41,690,113 V78D possibly damaging Het
Ccr3 T C 9: 124,029,414 V262A probably benign Het
Cdk13 A T 13: 17,721,305 probably null Het
Cdyl A T 13: 35,816,143 T136S possibly damaging Het
Chd2 T C 7: 73,471,819 D1015G probably null Het
Cntn2 C A 1: 132,522,363 A598S probably benign Het
Cxxc4 G T 3: 134,240,095 G146C unknown Het
Dnah2 G A 11: 69,458,158 T2501I probably benign Het
Dock8 T A 19: 25,097,535 I471N probably benign Het
Eaf2 A G 16: 36,824,683 V59A probably damaging Het
Egflam T A 15: 7,318,255 I65F probably damaging Het
Exoc3l A G 8: 105,290,701 V577A possibly damaging Het
Folh1 A T 7: 86,762,918 M215K probably benign Het
Fosb T C 7: 19,305,046 D271G possibly damaging Het
Frmd4b A G 6: 97,295,930 Y834H probably damaging Het
Fsip2 T C 2: 82,980,908 S2524P possibly damaging Het
Gbp3 A G 3: 142,565,263 T143A probably benign Het
Grk2 A T 19: 4,287,363 L632Q probably damaging Het
Hars A T 18: 36,770,184 D364E probably damaging Het
Hsd17b4 G T 18: 50,146,415 G154* probably null Het
Kif5c T C 2: 49,727,961 probably null Het
Kif5c T C 2: 49,749,327 L800P probably damaging Het
Krt19 T C 11: 100,141,392 N282S probably benign Het
Med23 T G 10: 24,909,920 probably null Het
Meltf A G 16: 31,880,267 Q65R probably benign Het
Mms22l T C 4: 24,598,842 S1106P probably damaging Het
Mprip A G 11: 59,764,416 T733A probably damaging Het
Mul1 G A 4: 138,434,769 G4S possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk G T 16: 34,922,183 V1022L probably benign Het
Ncald G T 15: 37,397,210 N75K probably damaging Het
Nfib A G 4: 82,320,494 S492P possibly damaging Het
Notch2 A T 3: 98,142,988 I1860F probably damaging Het
Olfr1499 A G 19: 13,814,747 I281T probably benign Het
Oxr1 T C 15: 41,819,867 S298P probably benign Het
Pcnt T C 10: 76,354,248 D2818G probably benign Het
Pmpcb G A 5: 21,743,452 A244T probably damaging Het
Poln A G 5: 34,116,807 probably null Het
Polr1a G A 6: 71,953,070 V914M probably damaging Het
Rasgrf1 G T 9: 89,994,694 S704I possibly damaging Het
Rsf1 GGCGGCGG GGCGGCGGGCGCGGCGG 7: 97,579,927 probably benign Het
Sart1 C A 19: 5,388,585 G15W probably damaging Het
Scrib T C 15: 76,047,393 *1666W probably null Het
Setd1b G C 5: 123,146,559 R184P unknown Het
Sfxn2 A T 19: 46,585,740 N123I probably damaging Het
Slc22a3 A G 17: 12,458,496 W262R probably damaging Het
Slc38a10 A G 11: 120,105,079 L1064P probably damaging Het
Sorcs2 A T 5: 36,024,072 S1077R possibly damaging Het
Them7 G T 2: 105,297,826 E51* probably null Het
Ubc A G 5: 125,388,069 S65P possibly damaging Het
Ubqln3 A T 7: 104,141,236 M549K possibly damaging Het
Vmn1r222 A G 13: 23,232,359 L228P probably damaging Het
Vmn2r60 A G 7: 42,195,111 T633A probably damaging Het
Zfp382 T C 7: 30,133,275 V117A probably benign Het
Zic1 C T 9: 91,365,692 probably benign Het
Zmym4 A T 4: 126,925,616 F165I probably benign Het
Other mutations in Rab15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02664:Rab15 APN 12 76804451 missense possibly damaging 0.91
PIT4486001:Rab15 UTSW 12 76801942 nonsense probably null
R4594:Rab15 UTSW 12 76800671 intron probably benign
R5009:Rab15 UTSW 12 76800567 missense probably damaging 1.00
R5959:Rab15 UTSW 12 76822269 missense probably damaging 1.00
R5972:Rab15 UTSW 12 76800603 missense probably damaging 0.99
R6878:Rab15 UTSW 12 76804483 missense probably benign 0.16
R7592:Rab15 UTSW 12 76804449 missense probably damaging 1.00
R7861:Rab15 UTSW 12 76803129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCCACAACGCTATTC -3'
(R):5'- GAAGGAGCTTGCTTCTGGTC -3'

Sequencing Primer
(F):5'- AACGCTATTCTACCAATTCCTCCGAC -3'
(R):5'- GAGCTTGCTTCTGGTCACCTC -3'
Posted On2019-11-26