Incidental Mutation 'R7765:Fcmr'
ID598163
Institutional Source Beutler Lab
Gene Symbol Fcmr
Ensembl Gene ENSMUSG00000042474
Gene NameFc fragment of IgM receptor
Synonyms1810037B05Rik, FcmuR, Faim3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130865669-130880791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130874288 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 93 (L93Q)
Ref Sequence ENSEMBL: ENSMUSP00000048303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829]
Predicted Effect probably damaging
Transcript: ENSMUST00000038829
AA Change: L93Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474
AA Change: L93Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Meta Mutation Damage Score 0.9090 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit a slight decrease in B cell numbers reduced sensitivity to Gal-induced liver damage, increased granulocyte production of ROS and increased sensitivity to infection by Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Fcmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Fcmr APN 1 130875122 missense probably benign 0.06
IGL01652:Fcmr APN 1 130878507 missense probably benign 0.25
IGL02106:Fcmr APN 1 130875135 missense probably benign
IGL03270:Fcmr APN 1 130876042 missense possibly damaging 0.63
R1635:Fcmr UTSW 1 130876185 splice site probably null
R1651:Fcmr UTSW 1 130878251 missense probably benign
R1728:Fcmr UTSW 1 130875974 missense probably benign
R1728:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1729:Fcmr UTSW 1 130875974 missense probably benign
R1729:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1730:Fcmr UTSW 1 130875974 missense probably benign
R1730:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1739:Fcmr UTSW 1 130875974 missense probably benign
R1739:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1762:Fcmr UTSW 1 130875974 missense probably benign
R1762:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1783:Fcmr UTSW 1 130875974 missense probably benign
R1783:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1784:Fcmr UTSW 1 130875974 missense probably benign
R1784:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1785:Fcmr UTSW 1 130875974 missense probably benign
R1785:Fcmr UTSW 1 130878269 missense probably benign 0.00
R2037:Fcmr UTSW 1 130878333 missense possibly damaging 0.61
R6111:Fcmr UTSW 1 130877829 missense probably damaging 0.96
R6217:Fcmr UTSW 1 130878323 missense probably damaging 0.96
R6538:Fcmr UTSW 1 130875025 missense possibly damaging 0.72
R6712:Fcmr UTSW 1 130877851 missense probably damaging 0.99
R6965:Fcmr UTSW 1 130875987 missense possibly damaging 0.65
X0025:Fcmr UTSW 1 130874267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTGGATCCATTATCATCG -3'
(R):5'- TCGGTCAACTGTGAAGTTAAGC -3'

Sequencing Primer
(F):5'- GGTGGATCCATTATCATCGAATGCC -3'
(R):5'- CAACTGTGAAGTTAAGCTGTGTTG -3'
Posted On2019-11-26