Incidental Mutation 'R7765:Lefty1'
ID598165
Institutional Source Beutler Lab
Gene Symbol Lefty1
Ensembl Gene ENSMUSG00000038793
Gene Nameleft right determination factor 1
Synonymslefty-1, Lefty, Stra3, Ebaf
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180935022-180938400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180936547 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000041427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037361]
Predicted Effect probably damaging
Transcript: ENSMUST00000037361
AA Change: E84G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041427
Gene: ENSMUSG00000038793
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:TGFb_propeptide 19 237 1.6e-13 PFAM
TGFB 265 356 5.78e-7 SMART
Meta Mutation Damage Score 0.2458 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in left-right asymmetry determination of organ systems during development. Mice lacking a functional copy of this gene exhibit embryonic lethality and defects in left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic and postnatal lethality, abnormal liver lobation, and a variety of left-right positional defects in visceral organs including left thoracic and atrial isomerism. A subset of mice homozygous for a differentnull allele show left pulmonary isomerism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Lefty1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Lefty1 APN 1 180937677 missense probably benign 0.01
IGL02974:Lefty1 APN 1 180935277 missense probably benign 0.21
R0230:Lefty1 UTSW 1 180937014 missense probably damaging 1.00
R0383:Lefty1 UTSW 1 180937634 nonsense probably null
R1976:Lefty1 UTSW 1 180937824 missense probably benign 0.01
R2351:Lefty1 UTSW 1 180937242 missense possibly damaging 0.80
R4027:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4028:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4029:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4030:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4719:Lefty1 UTSW 1 180937712 missense probably benign 0.01
R4761:Lefty1 UTSW 1 180937625 missense probably benign 0.40
R5476:Lefty1 UTSW 1 180937698 missense probably benign 0.06
R6151:Lefty1 UTSW 1 180935116 missense unknown
R6175:Lefty1 UTSW 1 180935149 missense unknown
R6362:Lefty1 UTSW 1 180937160 missense probably benign 0.39
R7153:Lefty1 UTSW 1 180937767 missense probably benign 0.01
R7678:Lefty1 UTSW 1 180936760 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGTTAGCATTCAGGGCC -3'
(R):5'- CCATTCAATGGTGACCCGAG -3'

Sequencing Primer
(F):5'- AGCATTCAGGGCCTCATTG -3'
(R):5'- AGCCCGGGCACTGTGTG -3'
Posted On2019-11-26