Incidental Mutation 'R7765:Brap'
ID598177
Institutional Source Beutler Lab
Gene Symbol Brap
Ensembl Gene ENSMUSG00000029458
Gene NameBRCA1 associated protein
Synonyms3010002G07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121660563-121687256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121662129 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 71 (D71V)
Ref Sequence ENSEMBL: ENSMUSP00000031414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000031414] [ENSMUST00000111765] [ENSMUST00000111770] [ENSMUST00000140996] [ENSMUST00000142701] [ENSMUST00000195952]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031414
AA Change: D71V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031414
Gene: ENSMUSG00000029458
AA Change: D71V

DomainStartEndE-ValueType
Pfam:BRAP2 153 251 3.7e-38 PFAM
RING 263 302 7.92e-8 SMART
ZnF_UBP 315 364 1.68e-25 SMART
coiled coil region 430 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111765
AA Change: D41V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107395
Gene: ENSMUSG00000029458
AA Change: D41V

DomainStartEndE-ValueType
Pfam:BRAP2 117 226 3.5e-41 PFAM
RING 233 272 3.7e-10 SMART
ZnF_UBP 285 334 1.1e-27 SMART
coiled coil region 400 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111770
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140996
AA Change: D71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000142701
AA Change: D27V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143043
Gene: ENSMUSG00000029458
AA Change: D27V

DomainStartEndE-ValueType
Pfam:BRAP2 103 175 3.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195952
AA Change: D30V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its ability to bind to the nuclear localization signal of BRCA1 and other proteins. It is a cytoplasmic protein which may regulate nuclear targeting by retaining proteins with a nuclear localization signal in the cytoplasm. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis and subtle defects in cell cycle-dependent nuclear movement in neural progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Brap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Brap APN 5 121665227 missense probably damaging 1.00
IGL01672:Brap APN 5 121678845 unclassified probably benign
IGL01889:Brap APN 5 121660818 missense probably benign 0.00
IGL01977:Brap APN 5 121678847 unclassified probably benign
IGL01978:Brap APN 5 121678847 unclassified probably benign
IGL01996:Brap APN 5 121678847 unclassified probably benign
IGL02499:Brap APN 5 121679871 missense probably damaging 0.99
IGL03137:Brap APN 5 121665093 splice site probably benign
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1624:Brap UTSW 5 121682859 missense possibly damaging 0.65
R1709:Brap UTSW 5 121665290 critical splice donor site probably null
R2056:Brap UTSW 5 121663466 missense probably damaging 1.00
R2109:Brap UTSW 5 121663359 missense possibly damaging 0.63
R3196:Brap UTSW 5 121665196 missense possibly damaging 0.70
R4591:Brap UTSW 5 121662050 missense probably null 1.00
R4744:Brap UTSW 5 121662130 missense probably damaging 1.00
R4924:Brap UTSW 5 121665255 missense probably damaging 1.00
R5000:Brap UTSW 5 121662026 nonsense probably null
R5702:Brap UTSW 5 121665143 missense probably damaging 1.00
R5893:Brap UTSW 5 121679342 nonsense probably null
R6244:Brap UTSW 5 121665309 missense probably benign 0.02
R6266:Brap UTSW 5 121685265 missense probably benign 0.00
R6726:Brap UTSW 5 121675302 missense probably damaging 1.00
R7995:Brap UTSW 5 121682846 missense probably benign
X0003:Brap UTSW 5 121679256 missense probably damaging 1.00
Z1176:Brap UTSW 5 121675377 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AAAAGAGCCTCATCCAGGGG -3'
(R):5'- ATCACATAAAGAACACAAGTGCTGG -3'

Sequencing Primer
(F):5'- CAGGAAAGCTATTGATTGATGTGCC -3'
(R):5'- GCGCTAGCCTTACATGTATGAAGC -3'
Posted On2019-11-26