Mutagenetix > Incidental Mutation

Incidental Mutation 'R7765:Cfap46'

598180

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7765 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139600951-139683817 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 139651564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 911 (D911A)

Ref Sequence

ENSEMBL: ENSMUSP00000120186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]

AlphaFold

E9Q2C0

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: D911A

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140820

SMART Domains

Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

Domain	Start	End	E-Value	Type
Blast:TPR	175	208	5e-11	BLAST
Blast:TPR	426	459	8e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155075

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	A	10: 116,113,253	K123*	probably null	Het
Adam2	T	C	14: 66,059,896	E187G	probably damaging	Het
Adam28	C	T	14: 68,609,106		probably null	Het
Ap2a1	G	A	7: 44,909,736	T189M	probably damaging	Het
Apaf1	A	G	10: 91,023,782	Y845H	probably benign	Het
Asb14	G	T	14: 26,897,761	V55F	probably benign	Het
Brap	A	T	5: 121,662,129	D71V	probably damaging	Het
Ccdc93	T	G	1: 121,499,313	F610V	probably damaging	Het
Chn2	T	C	6: 54,298,152		probably null	Het
Cib3	A	G	8: 72,204,425	F156S	probably damaging	Het
Ctif	A	T	18: 75,605,644	V164D	probably damaging	Het
Ddx27	T	A	2: 167,027,959	F405I	probably damaging	Het
Dnttip2	A	G	3: 122,275,945	T270A	probably benign	Het
Dst	T	A	1: 34,275,694	S4455T	probably damaging	Het
Efcab8	A	G	2: 153,843,190	K47R		Het
Efhd2	T	C	4: 141,874,575	E98G	probably damaging	Het
Fcmr	T	A	1: 130,874,288	L93Q	probably damaging	Het
Fhdc1	T	A	3: 84,444,599	E1106D	probably benign	Het
Gcnt1	C	T	19: 17,329,359	G334D	probably damaging	Het
Gm10031	G	A	1: 156,524,784	G185D	possibly damaging	Het
Hltf	T	C	3: 20,091,483	F488L	probably benign	Het
Hmgxb4	C	A	8: 75,000,808	H140N	probably damaging	Het
Ifi214	A	T	1: 173,524,836	F342L	probably damaging	Het
Ip6k1	A	G	9: 108,032,089	D105G	possibly damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kif18a	G	A	2: 109,306,940	D506N	probably benign	Het
Klf17	T	A	4: 117,760,615	M182L	probably benign	Het
Kmt2d	A	G	15: 98,852,334	F2493L	unknown	Het
Lefty1	A	G	1: 180,936,547	E84G	probably damaging	Het
Lyst	T	G	13: 13,709,532	L2975R	possibly damaging	Het
Magea5	G	A	X: 155,054,178	P73S	possibly damaging	Het
Mctp2	T	C	7: 72,090,331		probably null	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Myh8	T	A	11: 67,303,655	I1564N	probably benign	Het
Npc1	A	T	18: 12,195,048	M1068K	probably benign	Het
Nr2e1	A	G	10: 42,574,437	C60R	probably benign	Het
Nrxn3	A	G	12: 89,813,484	I29V	probably benign	Het
Ntsr1	T	A	2: 180,538,817	H305Q	probably damaging	Het
Olfr1100	T	A	2: 86,978,194	I201F	probably damaging	Het
Olfr1391	A	G	11: 49,327,744	E111G	probably damaging	Het
Olfr955	A	G	9: 39,470,316	S137P	probably benign	Het
Pate2	A	C	9: 35,669,901	E22D	probably benign	Het
Pcdhb22	A	G	18: 37,519,105	T209A	probably damaging	Het
Pdss2	C	T	10: 43,464,632	S352F	probably benign	Het
Pfn3	T	A	13: 55,415,087	D27V	probably damaging	Het
Pigg	T	G	5: 108,314,054	S84A	probably benign	Het
Prm3	CTCTTCTTCTTCTTC	CTCTTCTTCTTC	16: 10,790,701		probably benign	Het
Prss22	C	T	17: 23,994,618	G233E	probably damaging	Het
Rad51b	T	C	12: 79,803,270		probably null	Het
Scn10a	A	G	9: 119,609,904	V1632A	possibly damaging	Het
Serpinb3d	T	G	1: 107,079,782	D158A	probably damaging	Het
Sh3yl1	T	C	12: 30,958,869	L266P	probably damaging	Het
Sidt2	A	T	9: 45,941,575		probably null	Het
Stox1	C	T	10: 62,665,999	V261M	probably benign	Het
Tll1	A	G	8: 64,051,449	Y638H	probably damaging	Het
Tst	A	T	15: 78,405,616	M73K	possibly damaging	Het
Tuba4a	C	T	1: 75,216,359	V232M	probably benign	Het
Unk	T	A	11: 116,053,082	V343D	probably benign	Het
Usf3	T	C	16: 44,219,063	V1302A	probably benign	Het
Usp32	A	T	11: 84,994,408	L1271H	probably damaging	Het
Vwa5b2	C	T	16: 20,594,611	P192L	probably benign	Het
Zfp995	A	G	17: 21,882,003	Y38H	probably damaging	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139614443	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139666979	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139606607	missense	unknown
IGL02171:Cfap46	APN	7	139667056	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139682509	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139614470	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139607201	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139603252	missense	unknown
IGL03329:Cfap46	APN	7	139601165	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139638795	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139645551	missense
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139654566	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139651533	splice site	probably benign
R0650:Cfap46	UTSW	7	139605655	missense	unknown
R0675:Cfap46	UTSW	7	139676034	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139654670	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139655841	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139642597	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139601265	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139654629	nonsense	probably null
R1538:Cfap46	UTSW	7	139683008	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139652810	missense	probably benign	0.04
R1655:Cfap46	UTSW	7	139642520	nonsense	probably null
R1824:Cfap46	UTSW	7	139639602	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139640407	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139653408	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139683470	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139679903	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139667041	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139683761	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139661046	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139653498	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139617590	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139639599	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139678551	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139652673	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139650952	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139660082	intron	probably benign
R4595:Cfap46	UTSW	7	139652404	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139657281	missense	probably damaging	0.99
R4627:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4628:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139627456	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139679323	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139630608	missense	probably null
R4779:Cfap46	UTSW	7	139659815	intron	probably benign
R4812:Cfap46	UTSW	7	139636000	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139607188	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139627375	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139603860	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139661190	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139678514	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139613507	critical splice donor site	probably null
R5366:Cfap46	UTSW	7	139650886	missense	probably damaging	1.00
R5368:Cfap46	UTSW	7	139627473	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139632181	splice site	probably null
R5642:Cfap46	UTSW	7	139678577	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139638353	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139606700	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139612031	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139650942	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139651595	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139656580	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139661085	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139680831	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139614405	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139619971	missense	possibly damaging	0.92
R6760:Cfap46	UTSW	7	139652440	missense	probably damaging	1.00
R6773:Cfap46	UTSW	7	139642561	utr 3 prime	probably benign
R6835:Cfap46	UTSW	7	139652498	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139654561	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139639700	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139618078	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139617577	missense	unknown
R7327:Cfap46	UTSW	7	139635146	splice site	probably null
R7336:Cfap46	UTSW	7	139620104	missense	unknown
R7337:Cfap46	UTSW	7	139630576	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139650837	nonsense	probably null
R7450:Cfap46	UTSW	7	139617437	missense	unknown
R7495:Cfap46	UTSW	7	139603196	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139603239	missense
R7623:Cfap46	UTSW	7	139618350	missense	unknown
R7971:Cfap46	UTSW	7	139635127	missense	unknown
R8211:Cfap46	UTSW	7	139633304	missense	unknown
R8306:Cfap46	UTSW	7	139656580	missense
R8354:Cfap46	UTSW	7	139653498	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139683084	nonsense	probably null
R8447:Cfap46	UTSW	7	139680986	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139605644	missense
R8805:Cfap46	UTSW	7	139632063	missense	unknown
R8830:Cfap46	UTSW	7	139615649	missense	unknown
R8912:Cfap46	UTSW	7	139680181	intron	probably benign
R8920:Cfap46	UTSW	7	139652526	missense
R8977:Cfap46	UTSW	7	139679933	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139627343	missense	unknown
R9224:Cfap46	UTSW	7	139678500	nonsense	probably null
R9243:Cfap46	UTSW	7	139615349	intron	probably benign
R9252:Cfap46	UTSW	7	139618249	missense	unknown
R9276:Cfap46	UTSW	7	139621291	missense	unknown
R9301:Cfap46	UTSW	7	139642545	missense
R9391:Cfap46	UTSW	7	139618111	missense	unknown
R9402:Cfap46	UTSW	7	139635949	missense	unknown
R9443:Cfap46	UTSW	7	139615107	missense
R9564:Cfap46	UTSW	7	139651555	missense
R9625:Cfap46	UTSW	7	139650889	missense
R9626:Cfap46	UTSW	7	139650889	missense
R9638:Cfap46	UTSW	7	139629847	missense	unknown
R9656:Cfap46	UTSW	7	139655900	missense
R9658:Cfap46	UTSW	7	139666313	missense
R9747:Cfap46	UTSW	7	139611991	missense	unknown
RF023:Cfap46	UTSW	7	139638918
W0251:Cfap46	UTSW	7	139603946	missense	probably benign	0.11
X0018:Cfap46	UTSW	7	139680912	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139603447	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139635064	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139639548	missense
Z1177:Cfap46	UTSW	7	139601267	missense	unknown
Z1177:Cfap46	UTSW	7	139630626	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATACAGAGGCCAGACATGTG -3'
(R):5'- TCGAGACCAATGTTGCACAGG -3'

Sequencing Primer
(F):5'- CCAGACATGTGTGCTTTGAGAG -3'
(R):5'- CGAGACCAATGTTGCACAGGTTTATC -3'

Posted On

2019-11-26