Incidental Mutation 'R7765:Nr2e1'
ID598188
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Namenuclear receptor subfamily 2, group E, member 1
SynonymsMtll, Tlx, tailless, Nr2e1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location42561963-42583632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42574437 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 60 (C60R)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938]
Predicted Effect probably benign
Transcript: ENSMUST00000019938
AA Change: C60R

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: C60R

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42568453 missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42567973 missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42567979 missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42571482 missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42568381 missense probably damaging 1.00
Dubious UTSW 10 42571487 nonsense probably null
BB010:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42567968 missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42582909 unclassified probably null
R1879:Nr2e1 UTSW 10 42568371 critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42572778 missense probably benign
R2426:Nr2e1 UTSW 10 42563485 missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42568445 missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42578191 missense probably benign
R5305:Nr2e1 UTSW 10 42571487 nonsense probably null
R5316:Nr2e1 UTSW 10 42571491 missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42572784 missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42572769 missense probably benign
R7040:Nr2e1 UTSW 10 42568378 missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42563479 missense probably damaging 1.00
R7933:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42582885 missense probably benign 0.00
Z1177:Nr2e1 UTSW 10 42568427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCATAGGAGTGCCATC -3'
(R):5'- TAACCTGAGGTCGAGGACTG -3'

Sequencing Primer
(F):5'- GCATAGGAGTGCCATCTATTTTC -3'
(R):5'- GACACTCACTTACCTGGTAATGC -3'
Posted On2019-11-26