Incidental Mutation 'R7765:Olfr1391'
ID598193
Institutional Source Beutler Lab
Gene Symbol Olfr1391
Ensembl Gene ENSMUSG00000101874
Gene Nameolfactory receptor 1391
SynonymsGA_x6K02T2QP88-6107233-6106298, MOR256-27
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49322742-49329810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49327744 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 111 (E111G)
Ref Sequence ENSEMBL: ENSMUSP00000150635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187509] [ENSMUST00000215671]
Predicted Effect probably damaging
Transcript: ENSMUST00000187509
AA Change: E111G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140343
Gene: ENSMUSG00000101874
AA Change: E111G

DomainStartEndE-ValueType
Pfam:7tm_1 41 289 2.2e-29 PFAM
Pfam:7tm_4 139 282 6.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215671
AA Change: E111G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Olfr1391
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Olfr1391 APN 11 49328131 missense probably damaging 1.00
IGL02171:Olfr1391 APN 11 49328035 missense possibly damaging 0.69
IGL03184:Olfr1391 APN 11 49327741 missense probably damaging 0.97
R0471:Olfr1391 UTSW 11 49327917 missense probably damaging 1.00
R0613:Olfr1391 UTSW 11 49327748 missense possibly damaging 0.81
R0616:Olfr1391 UTSW 11 49327756 missense probably damaging 1.00
R0825:Olfr1391 UTSW 11 49327682 missense probably benign 0.00
R1613:Olfr1391 UTSW 11 49327693 missense probably damaging 1.00
R3429:Olfr1391 UTSW 11 49328041 missense probably benign 0.00
R3727:Olfr1391 UTSW 11 49327795 missense probably benign 0.01
R4256:Olfr1391 UTSW 11 49327477 missense probably benign 0.20
R4459:Olfr1391 UTSW 11 49327876 missense probably damaging 1.00
R4552:Olfr1391 UTSW 11 49327950 missense probably benign 0.00
R4811:Olfr1391 UTSW 11 49327748 missense possibly damaging 0.81
R4881:Olfr1391 UTSW 11 49328297 missense probably benign 0.43
R5838:Olfr1391 UTSW 11 49327933 missense probably damaging 0.99
R6804:Olfr1391 UTSW 11 49327981 missense probably benign 0.16
R6809:Olfr1391 UTSW 11 49327860 missense probably benign 0.00
R7763:Olfr1391 UTSW 11 49327671 missense probably benign 0.00
R7783:Olfr1391 UTSW 11 49328202 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACATTCGATTGCACACCCC -3'
(R):5'- TTGAGGAAGACAGGCATCTCAC -3'

Sequencing Primer
(F):5'- TCGATTGCACACCCCCATGTAC -3'
(R):5'- TGATTCAGTCGATACCTGCAGAG -3'
Posted On2019-11-26