Mutagenetix > Incidental Mutations

Incidental Mutation 'R7765:Usp32'

598196

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7765 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84994408 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1271 (L1271H)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108075
AA Change: L1271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L1271H

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	A	10: 116,113,253	K123*	probably null	Het
Adam2	T	C	14: 66,059,896	E187G	probably damaging	Het
Adam28	C	T	14: 68,609,106		probably null	Het
Ap2a1	G	A	7: 44,909,736	T189M	probably damaging	Het
Apaf1	A	G	10: 91,023,782	Y845H	probably benign	Het
Asb14	G	T	14: 26,897,761	V55F	probably benign	Het
Brap	A	T	5: 121,662,129	D71V	probably damaging	Het
Ccdc93	T	G	1: 121,499,313	F610V	probably damaging	Het
Cfap46	T	G	7: 139,651,564	D911A		Het
Chn2	T	C	6: 54,298,152		probably null	Het
Cib3	A	G	8: 72,204,425	F156S	probably damaging	Het
Ctif	A	T	18: 75,605,644	V164D	probably damaging	Het
Ddx27	T	A	2: 167,027,959	F405I	probably damaging	Het
Dnttip2	A	G	3: 122,275,945	T270A	probably benign	Het
Dst	T	A	1: 34,275,694	S4455T	probably damaging	Het
Efcab8	A	G	2: 153,843,190	K47R		Het
Efhd2	T	C	4: 141,874,575	E98G	probably damaging	Het
Fcmr	T	A	1: 130,874,288	L93Q	probably damaging	Het
Fhdc1	T	A	3: 84,444,599	E1106D	probably benign	Het
Gcnt1	C	T	19: 17,329,359	G334D	probably damaging	Het
Gm10031	G	A	1: 156,524,784	G185D	possibly damaging	Het
Hltf	T	C	3: 20,091,483	F488L	probably benign	Het
Hmgxb4	C	A	8: 75,000,808	H140N	probably damaging	Het
Ifi214	A	T	1: 173,524,836	F342L	probably damaging	Het
Ip6k1	A	G	9: 108,032,089	D105G	possibly damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kif18a	G	A	2: 109,306,940	D506N	probably benign	Het
Klf17	T	A	4: 117,760,615	M182L	probably benign	Het
Kmt2d	A	G	15: 98,852,334	F2493L	unknown	Het
Lefty1	A	G	1: 180,936,547	E84G	probably damaging	Het
Lyst	T	G	13: 13,709,532	L2975R	possibly damaging	Het
Magea5	G	A	X: 155,054,178	P73S	possibly damaging	Het
Mctp2	T	C	7: 72,090,331		probably null	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Myh8	T	A	11: 67,303,655	I1564N	probably benign	Het
Npc1	A	T	18: 12,195,048	M1068K	probably benign	Het
Nr2e1	A	G	10: 42,574,437	C60R	probably benign	Het
Nrxn3	A	G	12: 89,813,484	I29V	probably benign	Het
Ntsr1	T	A	2: 180,538,817	H305Q	probably damaging	Het
Olfr1100	T	A	2: 86,978,194	I201F	probably damaging	Het
Olfr1391	A	G	11: 49,327,744	E111G	probably damaging	Het
Olfr955	A	G	9: 39,470,316	S137P	probably benign	Het
Pate2	A	C	9: 35,669,901	E22D	probably benign	Het
Pcdhb22	A	G	18: 37,519,105	T209A	probably damaging	Het
Pdss2	C	T	10: 43,464,632	S352F	probably benign	Het
Pfn3	T	A	13: 55,415,087	D27V	probably damaging	Het
Pigg	T	G	5: 108,314,054	S84A	probably benign	Het
Prm3	CTCTTCTTCTTCTTC	CTCTTCTTCTTC	16: 10,790,701		probably benign	Het
Prss22	C	T	17: 23,994,618	G233E	probably damaging	Het
Rad51b	T	C	12: 79,803,270		probably null	Het
Scn10a	A	G	9: 119,609,904	V1632A	possibly damaging	Het
Serpinb3d	T	G	1: 107,079,782	D158A	probably damaging	Het
Sh3yl1	T	C	12: 30,958,869	L266P	probably damaging	Het
Sidt2	A	T	9: 45,941,575		probably null	Het
Stox1	C	T	10: 62,665,999	V261M	probably benign	Het
Tll1	A	G	8: 64,051,449	Y638H	probably damaging	Het
Tst	A	T	15: 78,405,616	M73K	possibly damaging	Het
Tuba4a	C	T	1: 75,216,359	V232M	probably benign	Het
Unk	T	A	11: 116,053,082	V343D	probably benign	Het
Usf3	T	C	16: 44,219,063	V1302A	probably benign	Het
Vwa5b2	C	T	16: 20,594,611	P192L	probably benign	Het
Zfp995	A	G	17: 21,882,003	Y38H	probably damaging	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGGATTAAAGGCATGTGC -3'
(R):5'- GGTGTTCATTTTAAATGCCCTCAG -3'

Sequencing Primer
(F):5'- TGTGCCACCATACCCAGGTAG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'

Posted On

2019-11-26