Incidental Mutation 'R7765:Usp32'
ID 598196
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7765 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84994408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1271 (L1271H)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: L1271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L1271H

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGGATTAAAGGCATGTGC -3'
(R):5'- GGTGTTCATTTTAAATGCCCTCAG -3'

Sequencing Primer
(F):5'- TGTGCCACCATACCCAGGTAG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'
Posted On 2019-11-26