Incidental Mutation 'R7765:Usp32'
ID598196
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84994408 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1271 (L1271H)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: L1271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L1271H

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGGATTAAAGGCATGTGC -3'
(R):5'- GGTGTTCATTTTAAATGCCCTCAG -3'

Sequencing Primer
(F):5'- TGTGCCACCATACCCAGGTAG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'
Posted On2019-11-26