Mutagenetix > Incidental Mutation

Incidental Mutation 'R7765:Usp32'

598196

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7765 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84994408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1271 (L1271H)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

AlphaFold

F8VPZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108075
AA Change: L1271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L1271H

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	A	10: 116,113,253	K123*	probably null	Het
Adam2	T	C	14: 66,059,896	E187G	probably damaging	Het
Adam28	C	T	14: 68,609,106		probably null	Het
Ap2a1	G	A	7: 44,909,736	T189M	probably damaging	Het
Apaf1	A	G	10: 91,023,782	Y845H	probably benign	Het
Asb14	G	T	14: 26,897,761	V55F	probably benign	Het
Brap	A	T	5: 121,662,129	D71V	probably damaging	Het
Ccdc93	T	G	1: 121,499,313	F610V	probably damaging	Het
Cfap46	T	G	7: 139,651,564	D911A		Het
Chn2	T	C	6: 54,298,152		probably null	Het
Cib3	A	G	8: 72,204,425	F156S	probably damaging	Het
Ctif	A	T	18: 75,605,644	V164D	probably damaging	Het
Ddx27	T	A	2: 167,027,959	F405I	probably damaging	Het
Dnttip2	A	G	3: 122,275,945	T270A	probably benign	Het
Dst	T	A	1: 34,275,694	S4455T	probably damaging	Het
Efcab8	A	G	2: 153,843,190	K47R		Het
Efhd2	T	C	4: 141,874,575	E98G	probably damaging	Het
Fcmr	T	A	1: 130,874,288	L93Q	probably damaging	Het
Fhdc1	T	A	3: 84,444,599	E1106D	probably benign	Het
Gcnt1	C	T	19: 17,329,359	G334D	probably damaging	Het
Gm10031	G	A	1: 156,524,784	G185D	possibly damaging	Het
Hltf	T	C	3: 20,091,483	F488L	probably benign	Het
Hmgxb4	C	A	8: 75,000,808	H140N	probably damaging	Het
Ifi214	A	T	1: 173,524,836	F342L	probably damaging	Het
Ip6k1	A	G	9: 108,032,089	D105G	possibly damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kif18a	G	A	2: 109,306,940	D506N	probably benign	Het
Klf17	T	A	4: 117,760,615	M182L	probably benign	Het
Kmt2d	A	G	15: 98,852,334	F2493L	unknown	Het
Lefty1	A	G	1: 180,936,547	E84G	probably damaging	Het
Lyst	T	G	13: 13,709,532	L2975R	possibly damaging	Het
Magea5	G	A	X: 155,054,178	P73S	possibly damaging	Het
Mctp2	T	C	7: 72,090,331		probably null	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Myh8	T	A	11: 67,303,655	I1564N	probably benign	Het
Npc1	A	T	18: 12,195,048	M1068K	probably benign	Het
Nr2e1	A	G	10: 42,574,437	C60R	probably benign	Het
Nrxn3	A	G	12: 89,813,484	I29V	probably benign	Het
Ntsr1	T	A	2: 180,538,817	H305Q	probably damaging	Het
Olfr1100	T	A	2: 86,978,194	I201F	probably damaging	Het
Olfr1391	A	G	11: 49,327,744	E111G	probably damaging	Het
Olfr955	A	G	9: 39,470,316	S137P	probably benign	Het
Pate2	A	C	9: 35,669,901	E22D	probably benign	Het
Pcdhb22	A	G	18: 37,519,105	T209A	probably damaging	Het
Pdss2	C	T	10: 43,464,632	S352F	probably benign	Het
Pfn3	T	A	13: 55,415,087	D27V	probably damaging	Het
Pigg	T	G	5: 108,314,054	S84A	probably benign	Het
Prm3	CTCTTCTTCTTCTTC	CTCTTCTTCTTC	16: 10,790,701		probably benign	Het
Prss22	C	T	17: 23,994,618	G233E	probably damaging	Het
Rad51b	T	C	12: 79,803,270		probably null	Het
Scn10a	A	G	9: 119,609,904	V1632A	possibly damaging	Het
Serpinb3d	T	G	1: 107,079,782	D158A	probably damaging	Het
Sh3yl1	T	C	12: 30,958,869	L266P	probably damaging	Het
Sidt2	A	T	9: 45,941,575		probably null	Het
Stox1	C	T	10: 62,665,999	V261M	probably benign	Het
Tll1	A	G	8: 64,051,449	Y638H	probably damaging	Het
Tst	A	T	15: 78,405,616	M73K	possibly damaging	Het
Tuba4a	C	T	1: 75,216,359	V232M	probably benign	Het
Unk	T	A	11: 116,053,082	V343D	probably benign	Het
Usf3	T	C	16: 44,219,063	V1302A	probably benign	Het
Vwa5b2	C	T	16: 20,594,611	P192L	probably benign	Het
Zfp995	A	G	17: 21,882,003	Y38H	probably damaging	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
R8924:Usp32	UTSW	11	85025544	missense	probably damaging	0.98
R9002:Usp32	UTSW	11	85053951	missense	probably damaging	0.96
R9145:Usp32	UTSW	11	85022292	missense	probably damaging	1.00
R9209:Usp32	UTSW	11	85040012	missense	probably damaging	0.98
R9211:Usp32	UTSW	11	85022733	missense	probably damaging	1.00
R9296:Usp32	UTSW	11	85017652	missense	probably damaging	1.00
R9310:Usp32	UTSW	11	85051202	missense	probably benign	0.29
R9417:Usp32	UTSW	11	84994543	missense	probably damaging	1.00
R9514:Usp32	UTSW	11	85022734	missense	probably damaging	0.99
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGGATTAAAGGCATGTGC -3'
(R):5'- GGTGTTCATTTTAAATGCCCTCAG -3'

Sequencing Primer
(F):5'- TGTGCCACCATACCCAGGTAG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'

Posted On

2019-11-26