Incidental Mutation 'R7765:Unk'
ID598197
Institutional Source Beutler Lab
Gene Symbol Unk
Ensembl Gene ENSMUSG00000020770
Gene Nameunkempt family zinc finger
SynonymsZc3h5, B230379M23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116030322-116061214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116053082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 343 (V343D)
Ref Sequence ENSEMBL: ENSMUSP00000021116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000106452]
Predicted Effect probably benign
Transcript: ENSMUST00000021116
AA Change: V343D

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770
AA Change: V343D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106452
AA Change: V343D

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770
AA Change: V343D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Unk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Unk APN 11 116058379 missense probably benign 0.44
IGL01956:Unk APN 11 116056334 missense probably damaging 1.00
IGL02044:Unk APN 11 116049328 missense probably damaging 0.99
IGL02738:Unk APN 11 116056191 missense probably damaging 1.00
IGL02861:Unk APN 11 116056299 missense possibly damaging 0.58
legal_midget UTSW 11 116050724 missense probably damaging 1.00
produce UTSW 11 116051459 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0827:Unk UTSW 11 116053109 missense possibly damaging 0.59
R1471:Unk UTSW 11 116049409 missense probably benign 0.45
R1824:Unk UTSW 11 116030442 unclassified probably benign
R1900:Unk UTSW 11 116059081 missense probably benign 0.01
R3052:Unk UTSW 11 116050123 missense probably benign 0.01
R4033:Unk UTSW 11 116053527 missense probably benign 0.00
R4449:Unk UTSW 11 116053634 missense probably damaging 1.00
R4593:Unk UTSW 11 116049056 missense probably benign 0.02
R4847:Unk UTSW 11 116054406 missense probably damaging 1.00
R4921:Unk UTSW 11 116054945 missense probably benign
R4940:Unk UTSW 11 116053665 missense possibly damaging 0.63
R5099:Unk UTSW 11 116059110 missense probably benign 0.00
R5838:Unk UTSW 11 116049331 missense probably damaging 1.00
R6351:Unk UTSW 11 116054946 missense probably benign
R6387:Unk UTSW 11 116054940 missense possibly damaging 0.88
R6551:Unk UTSW 11 116050724 missense probably damaging 1.00
R6554:Unk UTSW 11 116051459 missense probably damaging 1.00
R6599:Unk UTSW 11 116047802 missense probably damaging 1.00
R6733:Unk UTSW 11 116050755 missense probably damaging 1.00
R7743:Unk UTSW 11 116049436 missense possibly damaging 0.74
Z1176:Unk UTSW 11 116047764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAATGTAATAACTAGTTGCCTTGG -3'
(R):5'- CTACTGGCTCTGAAGATACATCCC -3'

Sequencing Primer
(F):5'- CCTTGGTGGCAGGGACATG -3'
(R):5'- TGGCCCCAGGACAAATACCAG -3'
Posted On2019-11-26