Incidental Mutation 'R7765:Adam2'
ID598204
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Namea disintegrin and metallopeptidase domain 2
Synonymsfertilin beta, Ftnb, Ph30-beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66027329-66077733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66059896 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 187 (E187G)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: E187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: E187G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66074049 critical splice donor site probably null
IGL00980:Adam2 APN 14 66056528 nonsense probably null
IGL01404:Adam2 APN 14 66077210 critical splice donor site probably null
IGL01901:Adam2 APN 14 66035229 splice site probably benign
IGL02687:Adam2 APN 14 66069190 missense probably damaging 1.00
IGL02692:Adam2 APN 14 66074087 missense probably damaging 1.00
IGL02695:Adam2 APN 14 66050480 missense probably benign 0.01
IGL02798:Adam2 APN 14 66040275 missense probably damaging 1.00
IGL03217:Adam2 APN 14 66034813 missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66053831 missense probably benign 0.03
sacher UTSW 14 66068558 missense probably damaging 1.00
zuker UTSW 14 66059912 missense probably benign 0.14
R0092:Adam2 UTSW 14 66053887 missense probably damaging 1.00
R0281:Adam2 UTSW 14 66037606 missense probably benign 0.20
R0636:Adam2 UTSW 14 66034816 missense probably benign 0.03
R0690:Adam2 UTSW 14 66057646 missense probably damaging 1.00
R0727:Adam2 UTSW 14 66029731 missense probably damaging 1.00
R1477:Adam2 UTSW 14 66077700 missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66057731 missense probably damaging 1.00
R1652:Adam2 UTSW 14 66077251 missense probably benign 0.41
R1717:Adam2 UTSW 14 66068558 missense probably damaging 1.00
R1868:Adam2 UTSW 14 66077658 missense probably damaging 0.99
R1915:Adam2 UTSW 14 66037557 missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66059912 missense probably benign 0.14
R3953:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3954:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3955:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3956:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3957:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R4091:Adam2 UTSW 14 66029723 missense probably damaging 0.97
R5673:Adam2 UTSW 14 66069232 missense probably benign 0.03
R5761:Adam2 UTSW 14 66046146 missense probably damaging 1.00
R6187:Adam2 UTSW 14 66068619 missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66058790 missense probably damaging 1.00
R6730:Adam2 UTSW 14 66037576 missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66027997 critical splice donor site probably null
R7023:Adam2 UTSW 14 66043056 missense probably benign 0.22
R7168:Adam2 UTSW 14 66058792 missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66053912 nonsense probably null
R7293:Adam2 UTSW 14 66035185 missense probably benign 0.29
R7604:Adam2 UTSW 14 66056541 missense probably benign 0.17
X0061:Adam2 UTSW 14 66053905 missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66056521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCCAGTTAGGACACAAG -3'
(R):5'- TGCCAGAAGTGACCAGAGTAAC -3'

Sequencing Primer
(F):5'- GGGCAAGAGTTTATTAAAATGCAC -3'
(R):5'- GTGACCAGAGTAACAGGCAG -3'
Posted On2019-11-26