Incidental Mutation 'R7765:Tst'
ID598206
Institutional Source Beutler Lab
Gene Symbol Tst
Ensembl Gene ENSMUSG00000044986
Gene Namethiosulfate sulfurtransferase, mitochondrial
SynonymsRhodanese
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78399556-78405907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78405616 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 73 (M73K)
Ref Sequence ENSEMBL: ENSMUSP00000055743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043865] [ENSMUST00000058659] [ENSMUST00000167140] [ENSMUST00000169133] [ENSMUST00000229739] [ENSMUST00000229791] [ENSMUST00000231159]
Predicted Effect probably benign
Transcript: ENSMUST00000043865
SMART Domains Protein: ENSMUSP00000043061
Gene: ENSMUSG00000071711

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000058659
AA Change: M73K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055743
Gene: ENSMUSG00000044986
AA Change: M73K

DomainStartEndE-ValueType
RHOD 11 140 2.88e-18 SMART
RHOD 163 285 1.48e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167140
SMART Domains Protein: ENSMUSP00000130493
Gene: ENSMUSG00000071711

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169133
SMART Domains Protein: ENSMUSP00000128075
Gene: ENSMUSG00000071711

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229739
Predicted Effect probably benign
Transcript: ENSMUST00000229791
Predicted Effect probably benign
Transcript: ENSMUST00000231159
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is one of two neighboring genes encoding similar proteins that each contain two rhodanese domains. The encoded protein is localized to the mitochondria and catalyzes the conversion of thiosulfate and cyanide to thiocyanate and sulfite. In addition, the protein interacts with 5S ribosomal RNA and facilitates its import into the mitochondria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Tst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Tst APN 15 78405461 missense probably damaging 1.00
IGL01457:Tst APN 15 78399767 missense probably benign 0.01
IGL01622:Tst APN 15 78399764 missense probably benign 0.06
IGL01623:Tst APN 15 78399764 missense probably benign 0.06
IGL03277:Tst APN 15 78405321 missense probably damaging 1.00
R0456:Tst UTSW 15 78405580 missense probably damaging 1.00
R1522:Tst UTSW 15 78399943 missense possibly damaging 0.67
R2518:Tst UTSW 15 78405833 start codon destroyed probably null 0.98
R5456:Tst UTSW 15 78399958 missense probably damaging 1.00
R7623:Tst UTSW 15 78405703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGAGCACTGACACTGTG -3'
(R):5'- TCGCAGAACTGACACTATGGTAC -3'

Sequencing Primer
(F):5'- ACTGACACTGTGCGGTG -3'
(R):5'- TCTACCGGGCGCTGGTATC -3'
Posted On2019-11-26