Incidental Mutation 'R7765:Kmt2d'
ID598207
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Namelysine (K)-specific methyltransferase 2D
SynonymsMll2, C430014K11Rik, Mll4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98831669-98871204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98852334 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2493 (F2493L)
Ref Sequence ENSEMBL: ENSMUSP00000023741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: F2493L
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: F2493L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: F2493L
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: F2493L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184363
SMART Domains Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98862333 missense unknown
IGL00927:Kmt2d APN 15 98845009 unclassified probably benign
IGL01123:Kmt2d APN 15 98837148 missense unknown
IGL01288:Kmt2d APN 15 98865044 missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98860657 unclassified probably benign
IGL01575:Kmt2d APN 15 98846855 utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98856369 unclassified probably benign
IGL01750:Kmt2d APN 15 98853168 unclassified probably benign
IGL02163:Kmt2d APN 15 98835228 unclassified probably benign
IGL02209:Kmt2d APN 15 98854567 unclassified probably benign
IGL02253:Kmt2d APN 15 98858175 unclassified probably benign
IGL02271:Kmt2d APN 15 98866428 missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98865492 splice site probably benign
IGL02448:Kmt2d APN 15 98844110 unclassified probably benign
IGL02472:Kmt2d APN 15 98850077 missense probably benign 0.23
IGL02496:Kmt2d APN 15 98857558 unclassified probably benign
IGL02527:Kmt2d APN 15 98841747 unclassified probably benign
IGL02576:Kmt2d APN 15 98864120 missense unknown
IGL02597:Kmt2d APN 15 98863831 missense unknown
IGL02609:Kmt2d APN 15 98851793 unclassified probably benign
IGL03085:Kmt2d APN 15 98839940 unclassified probably benign
IGL03102:Kmt2d APN 15 98855543 missense probably benign
IGL03123:Kmt2d APN 15 98861771 missense unknown
R0091:Kmt2d UTSW 15 98844479 unclassified probably benign
R0136:Kmt2d UTSW 15 98854278 unclassified probably benign
R0243:Kmt2d UTSW 15 98850137 unclassified probably benign
R0276:Kmt2d UTSW 15 98850311 unclassified probably benign
R0477:Kmt2d UTSW 15 98853581 unclassified probably benign
R0478:Kmt2d UTSW 15 98853581 unclassified probably benign
R0586:Kmt2d UTSW 15 98835207 unclassified probably benign
R0632:Kmt2d UTSW 15 98853581 unclassified probably benign
R0678:Kmt2d UTSW 15 98850413 unclassified probably benign
R0780:Kmt2d UTSW 15 98862857 missense unknown
R0891:Kmt2d UTSW 15 98852691 unclassified probably benign
R1136:Kmt2d UTSW 15 98857765 unclassified probably benign
R1417:Kmt2d UTSW 15 98866430 missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98844938 unclassified probably benign
R1510:Kmt2d UTSW 15 98856377 unclassified probably benign
R1586:Kmt2d UTSW 15 98865053 splice site probably benign
R1640:Kmt2d UTSW 15 98845057 unclassified probably benign
R1714:Kmt2d UTSW 15 98862950 missense unknown
R1725:Kmt2d UTSW 15 98845234 unclassified probably benign
R1728:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98845234 unclassified probably benign
R1744:Kmt2d UTSW 15 98865047 missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98864378 missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98843482 unclassified probably benign
R1782:Kmt2d UTSW 15 98857548 unclassified probably benign
R1789:Kmt2d UTSW 15 98852074 unclassified probably benign
R1802:Kmt2d UTSW 15 98862985 missense unknown
R1808:Kmt2d UTSW 15 98866686 missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98861780 missense unknown
R1831:Kmt2d UTSW 15 98855343 missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98855590 missense probably damaging 0.96
R1920:Kmt2d UTSW 15 98855591 missense probably damaging 1.00
R1956:Kmt2d UTSW 15 98859590 unclassified probably benign
R2100:Kmt2d UTSW 15 98846480 unclassified probably benign
R2120:Kmt2d UTSW 15 98839529 unclassified probably benign
R2188:Kmt2d UTSW 15 98839300 unclassified probably benign
R2191:Kmt2d UTSW 15 98861049 critical splice donor site probably null
R2234:Kmt2d UTSW 15 98865248 missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98862266 missense unknown
R2762:Kmt2d UTSW 15 98852055 unclassified probably benign
R2895:Kmt2d UTSW 15 98843939 unclassified probably benign
R3624:Kmt2d UTSW 15 98842902 unclassified probably benign
R3791:Kmt2d UTSW 15 98844149 unclassified probably benign
R3794:Kmt2d UTSW 15 98837359 unclassified probably benign
R3871:Kmt2d UTSW 15 98851021 unclassified probably benign
R3958:Kmt2d UTSW 15 98855549 missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98846046 unclassified probably benign
R4211:Kmt2d UTSW 15 98840189 unclassified probably benign
R4212:Kmt2d UTSW 15 98845003 unclassified probably benign
R4240:Kmt2d UTSW 15 98844571 unclassified probably benign
R4246:Kmt2d UTSW 15 98840089 unclassified probably benign
R4361:Kmt2d UTSW 15 98863670 missense unknown
R4388:Kmt2d UTSW 15 98853626 unclassified probably benign
R4602:Kmt2d UTSW 15 98850259 unclassified probably benign
R4606:Kmt2d UTSW 15 98839716 unclassified probably benign
R4658:Kmt2d UTSW 15 98852529 unclassified probably benign
R4840:Kmt2d UTSW 15 98861894 missense unknown
R4895:Kmt2d UTSW 15 98844487 unclassified probably benign
R4906:Kmt2d UTSW 15 98849539 unclassified probably benign
R4976:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98856162 missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98840224 unclassified probably benign
R5260:Kmt2d UTSW 15 98842860 unclassified probably benign
R5274:Kmt2d UTSW 15 98854230 unclassified probably benign
R5450:Kmt2d UTSW 15 98855086 missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98852109 unclassified probably benign
R5462:Kmt2d UTSW 15 98852109 unclassified probably benign
R5463:Kmt2d UTSW 15 98852109 unclassified probably benign
R5465:Kmt2d UTSW 15 98852109 unclassified probably benign
R5467:Kmt2d UTSW 15 98852109 unclassified probably benign
R5481:Kmt2d UTSW 15 98862005 missense unknown
R5509:Kmt2d UTSW 15 98839676 unclassified probably benign
R5534:Kmt2d UTSW 15 98837357 unclassified probably benign
R5536:Kmt2d UTSW 15 98852109 unclassified probably benign
R5537:Kmt2d UTSW 15 98852109 unclassified probably benign
R5538:Kmt2d UTSW 15 98852109 unclassified probably benign
R5546:Kmt2d UTSW 15 98853068 unclassified probably benign
R5595:Kmt2d UTSW 15 98850024 unclassified probably benign
R5645:Kmt2d UTSW 15 98844397 unclassified probably benign
R5679:Kmt2d UTSW 15 98854272 unclassified probably benign
R5710:Kmt2d UTSW 15 98854106 unclassified probably benign
R5755:Kmt2d UTSW 15 98863646 missense unknown
R5817:Kmt2d UTSW 15 98862363 missense unknown
R5841:Kmt2d UTSW 15 98852109 unclassified probably benign
R5842:Kmt2d UTSW 15 98852109 unclassified probably benign
R5843:Kmt2d UTSW 15 98852109 unclassified probably benign
R5844:Kmt2d UTSW 15 98852109 unclassified probably benign
R5845:Kmt2d UTSW 15 98852109 unclassified probably benign
R6122:Kmt2d UTSW 15 98860692 unclassified probably benign
R6612:Kmt2d UTSW 15 98845858 unclassified probably benign
R6718:Kmt2d UTSW 15 98849586 unclassified probably benign
R6718:Kmt2d UTSW 15 98850539 unclassified probably benign
R6822:Kmt2d UTSW 15 98849459 unclassified probably benign
R6866:Kmt2d UTSW 15 98857393 unclassified probably benign
R6950:Kmt2d UTSW 15 98840020 unclassified probably benign
R7089:Kmt2d UTSW 15 98850272 missense unknown
R7120:Kmt2d UTSW 15 98861065 missense unknown
R7131:Kmt2d UTSW 15 98849616 unclassified probably benign
R7177:Kmt2d UTSW 15 98850386 missense unknown
R7194:Kmt2d UTSW 15 98843833 missense unknown
R7252:Kmt2d UTSW 15 98844266 missense unknown
R7282:Kmt2d UTSW 15 98854104 missense unknown
R7307:Kmt2d UTSW 15 98849418 missense unknown
R7313:Kmt2d UTSW 15 98856623 missense unknown
R7394:Kmt2d UTSW 15 98856384 missense unknown
R7404:Kmt2d UTSW 15 98845495 missense unknown
R7409:Kmt2d UTSW 15 98855354 missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98839856 missense unknown
R7534:Kmt2d UTSW 15 98852018 missense unknown
R7575:Kmt2d UTSW 15 98849611 unclassified probably benign
R7650:Kmt2d UTSW 15 98850870 missense unknown
R7687:Kmt2d UTSW 15 98862120 missense unknown
R7699:Kmt2d UTSW 15 98843719 missense unknown
R7700:Kmt2d UTSW 15 98843719 missense unknown
R7797:Kmt2d UTSW 15 98864406 missense probably benign 0.24
R7803:Kmt2d UTSW 15 98862923 missense unknown
R8054:Kmt2d UTSW 15 98843925 missense unknown
R8084:Kmt2d UTSW 15 98842064 missense unknown
R8089:Kmt2d UTSW 15 98842869 missense unknown
R8133:Kmt2d UTSW 15 98864942 missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98843653 missense unknown
X0018:Kmt2d UTSW 15 98852922 unclassified probably benign
X0024:Kmt2d UTSW 15 98853053 unclassified probably benign
X0062:Kmt2d UTSW 15 98849819 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTTTGTGAGGCTCCATG -3'
(R):5'- CCCCTGAAGTTGCCTTTAAGG -3'

Sequencing Primer
(F):5'- AGGCTCCATGCGTCAAGTAG -3'
(R):5'- CATGCCAAGGTCCCAAG -3'
Posted On2019-11-26