Incidental Mutation 'R7765:Pcdhb22'
ID598214
Institutional Source Beutler Lab
Gene Symbol Pcdhb22
Ensembl Gene ENSMUSG00000073591
Gene Nameprotocadherin beta 22
SynonymsPcdhbV, Pcdhb15
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37517871-37524479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37519105 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 209 (T209A)
Ref Sequence ENSEMBL: ENSMUSP00000141521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000061405
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192409
AA Change: T209A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591
AA Change: T209A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gcnt1 C T 19: 17,329,359 G334D probably damaging Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Pcdhb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pcdhb22 APN 18 37520132 missense probably damaging 1.00
IGL00775:Pcdhb22 APN 18 37519742 missense probably benign 0.09
IGL01414:Pcdhb22 APN 18 37519496 missense probably damaging 1.00
IGL01819:Pcdhb22 APN 18 37519921 missense probably damaging 1.00
IGL02232:Pcdhb22 APN 18 37520549 missense probably damaging 1.00
IGL03226:Pcdhb22 APN 18 37518956 missense probably damaging 1.00
R0071:Pcdhb22 UTSW 18 37520078 missense probably damaging 1.00
R0363:Pcdhb22 UTSW 18 37519160 missense probably benign 0.01
R0454:Pcdhb22 UTSW 18 37518872 missense probably damaging 0.99
R0624:Pcdhb22 UTSW 18 37518727 missense probably benign 0.00
R0707:Pcdhb22 UTSW 18 37518851 missense probably damaging 1.00
R0918:Pcdhb22 UTSW 18 37520014 missense probably damaging 1.00
R1112:Pcdhb22 UTSW 18 37519768 missense possibly damaging 0.61
R1299:Pcdhb22 UTSW 18 37520590 missense probably damaging 0.99
R1351:Pcdhb22 UTSW 18 37518574 missense probably benign 0.10
R1488:Pcdhb22 UTSW 18 37519888 missense possibly damaging 0.79
R1595:Pcdhb22 UTSW 18 37520453 missense probably damaging 1.00
R1709:Pcdhb22 UTSW 18 37518500 missense probably benign 0.31
R1725:Pcdhb22 UTSW 18 37520188 missense probably benign 0.04
R1869:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1871:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1891:Pcdhb22 UTSW 18 37519304 missense probably damaging 0.97
R4523:Pcdhb22 UTSW 18 37520421 missense probably benign 0.05
R4825:Pcdhb22 UTSW 18 37520660 missense possibly damaging 0.80
R4831:Pcdhb22 UTSW 18 37520562 missense probably damaging 1.00
R4851:Pcdhb22 UTSW 18 37519034 missense possibly damaging 0.89
R4978:Pcdhb22 UTSW 18 37518601 missense probably benign 0.16
R5047:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5061:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5063:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5467:Pcdhb22 UTSW 18 37520135 missense probably benign 0.02
R6005:Pcdhb22 UTSW 18 37519736 missense possibly damaging 0.75
R6375:Pcdhb22 UTSW 18 37518304 intron probably benign
R6418:Pcdhb22 UTSW 18 37519906 missense possibly damaging 0.88
R6447:Pcdhb22 UTSW 18 37520216 missense possibly damaging 0.91
R6748:Pcdhb22 UTSW 18 37518746 missense probably damaging 0.99
R7195:Pcdhb22 UTSW 18 37519288 missense probably damaging 1.00
R7243:Pcdhb22 UTSW 18 37520632 missense probably benign 0.00
R7354:Pcdhb22 UTSW 18 37520258 missense probably damaging 1.00
R7503:Pcdhb22 UTSW 18 37519102 missense probably benign 0.39
R8201:Pcdhb22 UTSW 18 37518465 intron probably benign
X0027:Pcdhb22 UTSW 18 37520851 missense probably benign
Z1088:Pcdhb22 UTSW 18 37519345 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCCTGAAAGAGAAATGGCCGTG -3'
(R):5'- TTAGCAGAGACCTTAGCAACC -3'

Sequencing Primer
(F):5'- TCATAGAGAATAGCCCTGTTGG -3'
(R):5'- TTAGCAACCATGGAACCCGAGG -3'
Posted On2019-11-26