Incidental Mutation 'R7766:Nat10'
ID598224
Institutional Source Beutler Lab
Gene Symbol Nat10
Ensembl Gene ENSMUSG00000027185
Gene NameN-acetyltransferase 10
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7766 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location103721256-103761270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103725707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 923 (D923G)
Ref Sequence ENSEMBL: ENSMUSP00000028608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608]
Predicted Effect probably benign
Transcript: ENSMUST00000028608
AA Change: D923G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: D923G

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,638,341 F58S probably benign Het
Abca2 T A 2: 25,441,528 M1309K probably benign Het
Ascc1 A T 10: 60,004,819 M1L probably damaging Het
Ccdc85b A T 19: 5,456,852 S182R probably damaging Het
Cnpy3 G T 17: 46,737,235 Q185K possibly damaging Het
Cyp3a41a A G 5: 145,718,017 Y25H probably damaging Het
Dscam A T 16: 96,790,901 F725I probably benign Het
Duox1 T C 2: 122,337,301 F1022L probably benign Het
Ednrb A G 14: 103,843,289 L63P probably benign Het
Egr4 C T 6: 85,512,199 G293D probably damaging Het
Fv1 T A 4: 147,869,270 F98I possibly damaging Het
Gfm2 C T 13: 97,150,400 S169F probably damaging Het
Gm13089 T A 4: 143,699,239 I45F probably damaging Het
Hexim2 C G 11: 103,139,012 P297A probably benign Het
Hnrnpab G A 11: 51,601,466 T314I unknown Het
Ift88 T C 14: 57,447,654 F309S possibly damaging Het
Ins2 T A 7: 142,678,757 T97S probably benign Het
Itga2 T C 13: 114,853,891 I905V probably benign Het
Itgb8 T C 12: 119,163,359 Y720C probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna6 T A 6: 126,739,719 D69V probably damaging Het
Kcp A G 6: 29,496,847 C588R probably damaging Het
Lrrc17 A T 5: 21,561,044 T175S probably benign Het
Morc2b A T 17: 33,138,423 M125K probably benign Het
Ms4a4b A C 19: 11,449,988 M24L probably benign Het
Myh13 A C 11: 67,358,329 S1292R probably benign Het
Nelfcd G A 2: 174,426,832 A559T possibly damaging Het
Nipbl T C 15: 8,296,849 I2425M probably benign Het
Oasl1 G T 5: 114,937,110 A410S probably damaging Het
Olfr1015 T A 2: 85,785,658 I49N probably damaging Het
Olfr508 C T 7: 108,630,376 S128F probably benign Het
Olfr646 T A 7: 104,106,994 C238* probably null Het
Padi6 T C 4: 140,730,975 K507E probably benign Het
Pdcl2 T C 5: 76,317,896 N159S probably benign Het
Pla2g4a T C 1: 149,861,058 K445E probably benign Het
Plxnb2 A G 15: 89,161,271 S1028P probably benign Het
Polb T C 8: 22,653,091 S30G probably benign Het
Slc17a6 A T 7: 51,669,166 I519F probably benign Het
Tacc2 C T 7: 130,743,598 H2582Y probably damaging Het
Tnr A T 1: 159,888,310 T881S probably benign Het
Trp63 A T 16: 25,868,219 R394S probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Ttn T C 2: 76,814,698 T12938A probably damaging Het
Ugt2b35 A T 5: 87,001,202 D104V possibly damaging Het
Usp28 T C 9: 49,035,883 S835P probably damaging Het
Vmn2r44 A T 7: 8,368,220 V609E probably damaging Het
Zfp180 A G 7: 24,104,659 S168G probably benign Het
Other mutations in Nat10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nat10 APN 2 103725764 critical splice acceptor site probably null
IGL01062:Nat10 APN 2 103743048 missense probably damaging 1.00
IGL01524:Nat10 APN 2 103757757 missense probably damaging 1.00
IGL02553:Nat10 APN 2 103752668 missense probably damaging 1.00
IGL03040:Nat10 APN 2 103757265 splice site probably benign
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0268:Nat10 UTSW 2 103727917 splice site probably benign
R0422:Nat10 UTSW 2 103726729 nonsense probably null
R0423:Nat10 UTSW 2 103748227 missense probably damaging 0.98
R0788:Nat10 UTSW 2 103743115 missense probably damaging 1.00
R0946:Nat10 UTSW 2 103731374 missense probably damaging 0.99
R1353:Nat10 UTSW 2 103754073 missense possibly damaging 0.95
R2141:Nat10 UTSW 2 103731303 splice site probably null
R2142:Nat10 UTSW 2 103731303 splice site probably null
R2192:Nat10 UTSW 2 103726177 missense probably benign 0.00
R3904:Nat10 UTSW 2 103726247 splice site probably benign
R4183:Nat10 UTSW 2 103739813 missense probably damaging 1.00
R4496:Nat10 UTSW 2 103757739 missense probably damaging 1.00
R4578:Nat10 UTSW 2 103754072 missense probably damaging 1.00
R4589:Nat10 UTSW 2 103754070 missense probably damaging 1.00
R4639:Nat10 UTSW 2 103734889 missense probably benign 0.00
R4679:Nat10 UTSW 2 103732170 missense probably damaging 1.00
R4711:Nat10 UTSW 2 103748267 nonsense probably null
R5089:Nat10 UTSW 2 103757143 unclassified probably benign
R5103:Nat10 UTSW 2 103757260 missense probably damaging 0.97
R5108:Nat10 UTSW 2 103732203 missense probably damaging 0.97
R5134:Nat10 UTSW 2 103743293 missense probably benign 0.29
R5823:Nat10 UTSW 2 103730267 missense probably damaging 1.00
R5893:Nat10 UTSW 2 103721839 unclassified probably benign
R6135:Nat10 UTSW 2 103743316 missense probably damaging 1.00
R6455:Nat10 UTSW 2 103739886 missense possibly damaging 0.69
R6592:Nat10 UTSW 2 103754150 missense probably null 1.00
R6956:Nat10 UTSW 2 103734412 missense probably benign 0.01
R7036:Nat10 UTSW 2 103754108 missense probably benign 0.00
R7063:Nat10 UTSW 2 103748077 missense probably benign 0.01
R7172:Nat10 UTSW 2 103732969 missense probably damaging 1.00
R7226:Nat10 UTSW 2 103726753 missense probably benign 0.01
R7286:Nat10 UTSW 2 103754169 missense probably benign 0.02
R7448:Nat10 UTSW 2 103748045 missense probably damaging 0.99
R7470:Nat10 UTSW 2 103734881 missense probably benign 0.00
R7639:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7640:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7641:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7642:Nat10 UTSW 2 103726786 missense possibly damaging 0.94
R7787:Nat10 UTSW 2 103721863 missense unknown
R7910:Nat10 UTSW 2 103725145 missense probably benign 0.26
R7991:Nat10 UTSW 2 103725145 missense probably benign 0.26
X0024:Nat10 UTSW 2 103727881 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATGCAAGCCGTGTACCAGC -3'
(R):5'- TCTTCTCAGAGACCCCACTG -3'

Sequencing Primer
(F):5'- CGTGTACCAGCACCTCCAG -3'
(R):5'- GTGATCAGCTATGTTCCTAATGTC -3'
Posted On2019-11-26