Incidental Mutation 'R7766:Cyp3a41a'
ID598234
Institutional Source Beutler Lab
Gene Symbol Cyp3a41a
Ensembl Gene ENSMUSG00000075551
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 41A
Synonymssteroid inducible, Cyp3a41
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7766 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145694049-145720136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145718017 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 25 (Y25H)
Ref Sequence ENSEMBL: ENSMUSP00000091659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094111]
Predicted Effect probably damaging
Transcript: ENSMUST00000094111
AA Change: Y25H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091659
Gene: ENSMUSG00000075551
AA Change: Y25H

DomainStartEndE-ValueType
Pfam:p450 38 494 1.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,638,341 F58S probably benign Het
Abca2 T A 2: 25,441,528 M1309K probably benign Het
Ascc1 A T 10: 60,004,819 M1L probably damaging Het
Ccdc85b A T 19: 5,456,852 S182R probably damaging Het
Cnpy3 G T 17: 46,737,235 Q185K possibly damaging Het
Dscam A T 16: 96,790,901 F725I probably benign Het
Duox1 T C 2: 122,337,301 F1022L probably benign Het
Ednrb A G 14: 103,843,289 L63P probably benign Het
Egr4 C T 6: 85,512,199 G293D probably damaging Het
Fv1 T A 4: 147,869,270 F98I possibly damaging Het
Gfm2 C T 13: 97,150,400 S169F probably damaging Het
Gm13089 T A 4: 143,699,239 I45F probably damaging Het
Hexim2 C G 11: 103,139,012 P297A probably benign Het
Hnrnpab G A 11: 51,601,466 T314I unknown Het
Ift88 T C 14: 57,447,654 F309S possibly damaging Het
Ins2 T A 7: 142,678,757 T97S probably benign Het
Itga2 T C 13: 114,853,891 I905V probably benign Het
Itgb8 T C 12: 119,163,359 Y720C probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna6 T A 6: 126,739,719 D69V probably damaging Het
Kcp A G 6: 29,496,847 C588R probably damaging Het
Lrrc17 A T 5: 21,561,044 T175S probably benign Het
Morc2b A T 17: 33,138,423 M125K probably benign Het
Ms4a4b A C 19: 11,449,988 M24L probably benign Het
Myh13 A C 11: 67,358,329 S1292R probably benign Het
Nat10 T C 2: 103,725,707 D923G probably benign Het
Nelfcd G A 2: 174,426,832 A559T possibly damaging Het
Nipbl T C 15: 8,296,849 I2425M probably benign Het
Oasl1 G T 5: 114,937,110 A410S probably damaging Het
Olfr1015 T A 2: 85,785,658 I49N probably damaging Het
Olfr508 C T 7: 108,630,376 S128F probably benign Het
Olfr646 T A 7: 104,106,994 C238* probably null Het
Padi6 T C 4: 140,730,975 K507E probably benign Het
Pdcl2 T C 5: 76,317,896 N159S probably benign Het
Pla2g4a T C 1: 149,861,058 K445E probably benign Het
Plxnb2 A G 15: 89,161,271 S1028P probably benign Het
Polb T C 8: 22,653,091 S30G probably benign Het
Slc17a6 A T 7: 51,669,166 I519F probably benign Het
Tacc2 C T 7: 130,743,598 H2582Y probably damaging Het
Tmem176a A T 6: 48,844,182 probably null Het
Tnr A T 1: 159,888,310 T881S probably benign Het
Trp63 A T 16: 25,868,219 R394S probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Ttn T C 2: 76,814,698 T12938A probably damaging Het
Ugt2b35 A T 5: 87,001,202 D104V possibly damaging Het
Usp28 T C 9: 49,035,883 S835P probably damaging Het
Vmn2r44 A T 7: 8,368,220 V609E probably damaging Het
Zfp180 A G 7: 24,104,659 S168G probably benign Het
Other mutations in Cyp3a41a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02284:Cyp3a41a APN 5 145704863 splice site probably benign
IGL03003:Cyp3a41a APN 5 145705830 missense probably benign
R0006:Cyp3a41a UTSW 5 145704796 missense probably benign 0.01
R0515:Cyp3a41a UTSW 5 145718000 missense probably damaging 1.00
R1052:Cyp3a41a UTSW 5 145705811 missense possibly damaging 0.49
R3708:Cyp3a41a UTSW 5 145717923 critical splice donor site probably null
R4049:Cyp3a41a UTSW 5 145713540 missense probably damaging 1.00
R4755:Cyp3a41a UTSW 5 145715506 missense probably damaging 1.00
R4975:Cyp3a41a UTSW 5 145720048 start codon destroyed probably null 1.00
R6519:Cyp3a41a UTSW 5 145715498 missense probably damaging 1.00
R6788:Cyp3a41a UTSW 5 145705829 missense probably benign 0.00
R7184:Cyp3a41a UTSW 5 145705853 missense probably benign 0.01
R7372:Cyp3a41a UTSW 5 145713564 missense possibly damaging 0.67
R7451:Cyp3a41a UTSW 5 145699740 missense probably benign 0.10
R7463:Cyp3a41a UTSW 5 145713564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGTATGAGGACCTGATATCTC -3'
(R):5'- TCCCTAGATCCATGAGAACTCAG -3'

Sequencing Primer
(F):5'- CTCAGGATTTCCTCAGTAGAAGC -3'
(R):5'- GCATACATGAATACCAGCAGTTG -3'
Posted On2019-11-26