Incidental Mutation 'R7766:Olfr646'
ID 598242
Institutional Source Beutler Lab
Gene Symbol Olfr646
Ensembl Gene ENSMUSG00000073931
Gene Name olfactory receptor 646
Synonyms GA_x6K02T2PBJ9-6841330-6842268, MOR33-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R7766 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104104873-104109766 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 104106994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 238 (C238*)
Ref Sequence ENSEMBL: ENSMUSP00000149102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
AlphaFold Q8VGW2
Predicted Effect probably null
Transcript: ENSMUST00000098182
AA Change: C238*
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: C238*

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000214099
AA Change: C238*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,638,341 F58S probably benign Het
Abca2 T A 2: 25,441,528 M1309K probably benign Het
Ascc1 A T 10: 60,004,819 M1L probably damaging Het
Ccdc85b A T 19: 5,456,852 S182R probably damaging Het
Cnpy3 G T 17: 46,737,235 Q185K possibly damaging Het
Cyp3a41a A G 5: 145,718,017 Y25H probably damaging Het
Dscam A T 16: 96,790,901 F725I probably benign Het
Duox1 T C 2: 122,337,301 F1022L probably benign Het
Ednrb A G 14: 103,843,289 L63P probably benign Het
Egr4 C T 6: 85,512,199 G293D probably damaging Het
Fv1 T A 4: 147,869,270 F98I possibly damaging Het
Gfm2 C T 13: 97,150,400 S169F probably damaging Het
Gm13089 T A 4: 143,699,239 I45F probably damaging Het
Hexim2 C G 11: 103,139,012 P297A probably benign Het
Hnrnpab G A 11: 51,601,466 T314I unknown Het
Ift88 T C 14: 57,447,654 F309S possibly damaging Het
Ins2 T A 7: 142,678,757 T97S probably benign Het
Itga2 T C 13: 114,853,891 I905V probably benign Het
Itgb8 T C 12: 119,163,359 Y720C probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna6 T A 6: 126,739,719 D69V probably damaging Het
Kcp A G 6: 29,496,847 C588R probably damaging Het
Lrrc17 A T 5: 21,561,044 T175S probably benign Het
Morc2b A T 17: 33,138,423 M125K probably benign Het
Ms4a4b A C 19: 11,449,988 M24L probably benign Het
Myh13 A C 11: 67,358,329 S1292R probably benign Het
Nat10 T C 2: 103,725,707 D923G probably benign Het
Nelfcd G A 2: 174,426,832 A559T possibly damaging Het
Nipbl T C 15: 8,296,849 I2425M probably benign Het
Oasl1 G T 5: 114,937,110 A410S probably damaging Het
Olfr1015 T A 2: 85,785,658 I49N probably damaging Het
Olfr508 C T 7: 108,630,376 S128F probably benign Het
Padi6 T C 4: 140,730,975 K507E probably benign Het
Pdcl2 T C 5: 76,317,896 N159S probably benign Het
Pla2g4a T C 1: 149,861,058 K445E probably benign Het
Plxnb2 A G 15: 89,161,271 S1028P probably benign Het
Polb T C 8: 22,653,091 S30G probably benign Het
Slc17a6 A T 7: 51,669,166 I519F probably benign Het
Tacc2 C T 7: 130,743,598 H2582Y probably damaging Het
Tmem176a A T 6: 48,844,182 probably null Het
Tnr A T 1: 159,888,310 T881S probably benign Het
Trp63 A T 16: 25,868,219 R394S probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Ttn T C 2: 76,814,698 T12938A probably damaging Het
Ugt2b35 A T 5: 87,001,202 D104V possibly damaging Het
Usp28 T C 9: 49,035,883 S835P probably damaging Het
Vmn2r44 A T 7: 8,368,220 V609E probably damaging Het
Zfp180 A G 7: 24,104,659 S168G probably benign Het
Other mutations in Olfr646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Olfr646 APN 7 104106633 missense probably damaging 1.00
IGL02454:Olfr646 APN 7 104106612 missense probably damaging 0.96
IGL02588:Olfr646 APN 7 104107053 missense possibly damaging 0.94
IGL02961:Olfr646 APN 7 104107150 nonsense probably null
IGL03092:Olfr646 APN 7 104106647 missense probably damaging 0.99
PIT4402001:Olfr646 UTSW 7 104106450 missense probably damaging 1.00
R0006:Olfr646 UTSW 7 104106320 missense probably benign 0.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0601:Olfr646 UTSW 7 104107142 missense possibly damaging 0.83
R0732:Olfr646 UTSW 7 104106294 missense probably damaging 1.00
R1320:Olfr646 UTSW 7 104106480 missense probably damaging 1.00
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1513:Olfr646 UTSW 7 104106464 missense probably benign 0.02
R5486:Olfr646 UTSW 7 104106498 missense probably damaging 0.99
R6110:Olfr646 UTSW 7 104106572 missense probably damaging 1.00
R6497:Olfr646 UTSW 7 104107215 intron probably benign
R6856:Olfr646 UTSW 7 104106791 missense probably benign 0.00
R7789:Olfr646 UTSW 7 104106988 missense probably damaging 0.99
R7844:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
R8888:Olfr646 UTSW 7 104107095 missense probably damaging 1.00
R8895:Olfr646 UTSW 7 104107095 missense probably damaging 1.00
R9167:Olfr646 UTSW 7 104107219 makesense probably null
R9178:Olfr646 UTSW 7 104106513 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTGCTAGGCTTGCCTGTG -3'
(R):5'- TCATACTAAGTCCTTCCCCAAGTG -3'

Sequencing Primer
(F):5'- GCTTGCCTGTGCCAATATTACTG -3'
(R):5'- AGTTTTAGAAGCCGACTCCG -3'
Posted On 2019-11-26