Incidental Mutation 'R7766:Ascc1'
ID598248
Institutional Source Beutler Lab
Gene Symbol Ascc1
Ensembl Gene ENSMUSG00000044475
Gene Nameactivating signal cointegrator 1 complex subunit 1
Synonyms1810015P09Rik, ASC1p50, CGI-18
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R7766 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location60002805-60099988 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 60004819 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000052351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020307] [ENSMUST00000050516] [ENSMUST00000164083] [ENSMUST00000182116] [ENSMUST00000182152] [ENSMUST00000182898] [ENSMUST00000182912]
Predicted Effect probably benign
Transcript: ENSMUST00000020307
SMART Domains Protein: ENSMUSP00000020307
Gene: ENSMUSG00000020107

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050516
AA Change: M1L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052351
Gene: ENSMUSG00000044475
AA Change: M1L

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 4.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164083
AA Change: M1L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126301
Gene: ENSMUSG00000044475
AA Change: M1L

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182116
Predicted Effect probably benign
Transcript: ENSMUST00000182152
SMART Domains Protein: ENSMUSP00000138579
Gene: ENSMUSG00000020107

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182898
SMART Domains Protein: ENSMUSP00000138112
Gene: ENSMUSG00000020107

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182912
Meta Mutation Damage Score 0.7657 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,638,341 F58S probably benign Het
Abca2 T A 2: 25,441,528 M1309K probably benign Het
Ccdc85b A T 19: 5,456,852 S182R probably damaging Het
Cnpy3 G T 17: 46,737,235 Q185K possibly damaging Het
Cyp3a41a A G 5: 145,718,017 Y25H probably damaging Het
Dscam A T 16: 96,790,901 F725I probably benign Het
Duox1 T C 2: 122,337,301 F1022L probably benign Het
Ednrb A G 14: 103,843,289 L63P probably benign Het
Egr4 C T 6: 85,512,199 G293D probably damaging Het
Fv1 T A 4: 147,869,270 F98I possibly damaging Het
Gfm2 C T 13: 97,150,400 S169F probably damaging Het
Gm13089 T A 4: 143,699,239 I45F probably damaging Het
Hexim2 C G 11: 103,139,012 P297A probably benign Het
Hnrnpab G A 11: 51,601,466 T314I unknown Het
Ift88 T C 14: 57,447,654 F309S possibly damaging Het
Ins2 T A 7: 142,678,757 T97S probably benign Het
Itga2 T C 13: 114,853,891 I905V probably benign Het
Itgb8 T C 12: 119,163,359 Y720C probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna6 T A 6: 126,739,719 D69V probably damaging Het
Kcp A G 6: 29,496,847 C588R probably damaging Het
Lrrc17 A T 5: 21,561,044 T175S probably benign Het
Morc2b A T 17: 33,138,423 M125K probably benign Het
Ms4a4b A C 19: 11,449,988 M24L probably benign Het
Myh13 A C 11: 67,358,329 S1292R probably benign Het
Nat10 T C 2: 103,725,707 D923G probably benign Het
Nelfcd G A 2: 174,426,832 A559T possibly damaging Het
Nipbl T C 15: 8,296,849 I2425M probably benign Het
Oasl1 G T 5: 114,937,110 A410S probably damaging Het
Olfr1015 T A 2: 85,785,658 I49N probably damaging Het
Olfr508 C T 7: 108,630,376 S128F probably benign Het
Olfr646 T A 7: 104,106,994 C238* probably null Het
Padi6 T C 4: 140,730,975 K507E probably benign Het
Pdcl2 T C 5: 76,317,896 N159S probably benign Het
Pla2g4a T C 1: 149,861,058 K445E probably benign Het
Plxnb2 A G 15: 89,161,271 S1028P probably benign Het
Polb T C 8: 22,653,091 S30G probably benign Het
Slc17a6 A T 7: 51,669,166 I519F probably benign Het
Tacc2 C T 7: 130,743,598 H2582Y probably damaging Het
Tmem176a A T 6: 48,844,182 probably null Het
Tnr A T 1: 159,888,310 T881S probably benign Het
Trp63 A T 16: 25,868,219 R394S probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Ttn T C 2: 76,814,698 T12938A probably damaging Het
Ugt2b35 A T 5: 87,001,202 D104V possibly damaging Het
Usp28 T C 9: 49,035,883 S835P probably damaging Het
Vmn2r44 A T 7: 8,368,220 V609E probably damaging Het
Zfp180 A G 7: 24,104,659 S168G probably benign Het
Other mutations in Ascc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Ascc1 APN 10 60012458 splice site probably benign
Dagger UTSW 10 60013653 missense probably damaging 1.00
stiletto UTSW 10 60004819 start codon destroyed probably damaging 1.00
R1307:Ascc1 UTSW 10 60012499 missense probably benign 0.00
R1463:Ascc1 UTSW 10 60062516 missense probably benign 0.17
R2403:Ascc1 UTSW 10 60004841 missense probably benign 0.20
R4308:Ascc1 UTSW 10 60013612 missense probably benign 0.00
R4703:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4704:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4705:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4916:Ascc1 UTSW 10 60004862 missense probably benign 0.01
R6906:Ascc1 UTSW 10 60004852 missense probably benign 0.01
R6944:Ascc1 UTSW 10 60013653 missense probably damaging 1.00
R7227:Ascc1 UTSW 10 60007738 missense probably benign 0.08
R7661:Ascc1 UTSW 10 60049807 missense probably damaging 1.00
R7940:Ascc1 UTSW 10 60012559 missense probably null 1.00
R8104:Ascc1 UTSW 10 60007729 missense probably benign
R8721:Ascc1 UTSW 10 60098106 missense possibly damaging 0.91
Z1176:Ascc1 UTSW 10 60007793 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CTACTTGCCTACATAATGGAGTTTC -3'
(R):5'- TTATTAGACCCACTGAGCAGC -3'

Sequencing Primer
(F):5'- ACCTGGCTGCATGTGTAGTCC -3'
(R):5'- AAGCAAAGAATTACCCTTACAGTAC -3'
Posted On2019-11-26