Incidental Mutation 'R7766:Myh13'
ID 598250
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, MyHC-eo, extraocular myosin
MMRRC Submission 045822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R7766 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67217929-67262413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 67249155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1292 (S1292R)
Ref Sequence ENSEMBL: ENSMUSP00000080584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: S1292R

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: S1292R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: S1292R

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: S1292R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: S1292R

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: S1292R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,300 (GRCm39) F58S probably benign Het
Abca2 T A 2: 25,331,540 (GRCm39) M1309K probably benign Het
Ascc1 A T 10: 59,840,641 (GRCm39) M1L probably damaging Het
Ccdc85b A T 19: 5,506,880 (GRCm39) S182R probably damaging Het
Cnpy3 G T 17: 47,048,161 (GRCm39) Q185K possibly damaging Het
Cyp3a41a A G 5: 145,654,827 (GRCm39) Y25H probably damaging Het
Dscam A T 16: 96,592,101 (GRCm39) F725I probably benign Het
Duox1 T C 2: 122,167,782 (GRCm39) F1022L probably benign Het
Ednrb A G 14: 104,080,725 (GRCm39) L63P probably benign Het
Egr4 C T 6: 85,489,181 (GRCm39) G293D probably damaging Het
Fv1 T A 4: 147,953,727 (GRCm39) F98I possibly damaging Het
Gfm2 C T 13: 97,286,908 (GRCm39) S169F probably damaging Het
Hexim2 C G 11: 103,029,838 (GRCm39) P297A probably benign Het
Hnrnpab G A 11: 51,492,293 (GRCm39) T314I unknown Het
Ift88 T C 14: 57,685,111 (GRCm39) F309S possibly damaging Het
Ins2 T A 7: 142,232,494 (GRCm39) T97S probably benign Het
Itga2 T C 13: 114,990,427 (GRCm39) I905V probably benign Het
Itgb8 T C 12: 119,127,094 (GRCm39) Y720C probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kcna6 T A 6: 126,716,682 (GRCm39) D69V probably damaging Het
Kcp A G 6: 29,496,846 (GRCm39) C588R probably damaging Het
Lrrc17 A T 5: 21,766,042 (GRCm39) T175S probably benign Het
Morc2b A T 17: 33,357,397 (GRCm39) M125K probably benign Het
Ms4a4b A C 19: 11,427,352 (GRCm39) M24L probably benign Het
Nat10 T C 2: 103,556,052 (GRCm39) D923G probably benign Het
Nelfcd G A 2: 174,268,625 (GRCm39) A559T possibly damaging Het
Nipbl T C 15: 8,326,333 (GRCm39) I2425M probably benign Het
Oasl1 G T 5: 115,075,169 (GRCm39) A410S probably damaging Het
Or52d1 T A 7: 103,756,201 (GRCm39) C238* probably null Het
Or5p80 C T 7: 108,229,583 (GRCm39) S128F probably benign Het
Or9g4b T A 2: 85,616,002 (GRCm39) I49N probably damaging Het
Padi6 T C 4: 140,458,286 (GRCm39) K507E probably benign Het
Pdcl2 T C 5: 76,465,743 (GRCm39) N159S probably benign Het
Pla2g4a T C 1: 149,736,809 (GRCm39) K445E probably benign Het
Plxnb2 A G 15: 89,045,474 (GRCm39) S1028P probably benign Het
Polb T C 8: 23,143,107 (GRCm39) S30G probably benign Het
Pramel23 T A 4: 143,425,809 (GRCm39) I45F probably damaging Het
Slc17a6 A T 7: 51,318,914 (GRCm39) I519F probably benign Het
Tacc2 C T 7: 130,345,328 (GRCm39) H2582Y probably damaging Het
Tmem176a A T 6: 48,821,116 (GRCm39) probably null Het
Tnr A T 1: 159,715,880 (GRCm39) T881S probably benign Het
Trp63 A T 16: 25,686,969 (GRCm39) R394S probably damaging Het
Tsga8 A G X: 82,530,704 (GRCm39) L135P unknown Het
Ttn T C 2: 76,645,042 (GRCm39) T12938A probably damaging Het
Ugt2b35 A T 5: 87,149,061 (GRCm39) D104V possibly damaging Het
Usp28 T C 9: 48,947,183 (GRCm39) S835P probably damaging Het
Vmn2r44 A T 7: 8,371,219 (GRCm39) V609E probably damaging Het
Zfp180 A G 7: 23,804,084 (GRCm39) S168G probably benign Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67,233,314 (GRCm39) missense probably damaging 1.00
IGL00808:Myh13 APN 11 67,225,830 (GRCm39) critical splice donor site probably null
IGL00822:Myh13 APN 11 67,252,154 (GRCm39) missense probably damaging 0.98
IGL00823:Myh13 APN 11 67,246,773 (GRCm39) missense probably benign 0.00
IGL00945:Myh13 APN 11 67,238,832 (GRCm39) missense probably null 1.00
IGL01414:Myh13 APN 11 67,233,298 (GRCm39) missense probably benign 0.02
IGL01482:Myh13 APN 11 67,242,894 (GRCm39) missense probably benign
IGL01523:Myh13 APN 11 67,238,769 (GRCm39) missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67,260,045 (GRCm39) unclassified probably benign
IGL01997:Myh13 APN 11 67,257,992 (GRCm39) missense probably benign 0.14
IGL02369:Myh13 APN 11 67,251,100 (GRCm39) unclassified probably benign
IGL02478:Myh13 APN 11 67,260,204 (GRCm39) missense probably benign
IGL02663:Myh13 APN 11 67,245,753 (GRCm39) nonsense probably null
IGL02851:Myh13 APN 11 67,239,742 (GRCm39) missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67,223,367 (GRCm39) missense probably damaging 1.00
IGL02929:Myh13 APN 11 67,257,991 (GRCm39) missense probably damaging 1.00
IGL02979:Myh13 APN 11 67,225,788 (GRCm39) missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67,235,679 (GRCm39) missense probably damaging 0.99
IGL03214:Myh13 APN 11 67,244,411 (GRCm39) missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67,241,068 (GRCm39) missense probably benign 0.39
IGL03231:Myh13 APN 11 67,242,817 (GRCm39) missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67,242,978 (GRCm39) missense probably damaging 1.00
3-1:Myh13 UTSW 11 67,242,777 (GRCm39) splice site probably benign
P0042:Myh13 UTSW 11 67,225,817 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0379:Myh13 UTSW 11 67,260,121 (GRCm39) unclassified probably benign
R0496:Myh13 UTSW 11 67,239,641 (GRCm39) missense probably damaging 1.00
R0584:Myh13 UTSW 11 67,251,200 (GRCm39) nonsense probably null
R0595:Myh13 UTSW 11 67,235,672 (GRCm39) missense probably benign 0.03
R0621:Myh13 UTSW 11 67,232,058 (GRCm39) missense probably damaging 0.98
R0834:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67,225,427 (GRCm39) missense probably damaging 1.00
R0964:Myh13 UTSW 11 67,235,828 (GRCm39) missense probably benign 0.02
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0974:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R1028:Myh13 UTSW 11 67,247,007 (GRCm39) missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67,245,576 (GRCm39) missense probably damaging 1.00
R1283:Myh13 UTSW 11 67,261,747 (GRCm39) missense probably damaging 1.00
R1288:Myh13 UTSW 11 67,244,544 (GRCm39) missense probably benign 0.00
R1386:Myh13 UTSW 11 67,261,776 (GRCm39) missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67,221,872 (GRCm39) missense probably damaging 0.97
R1503:Myh13 UTSW 11 67,244,500 (GRCm39) missense probably benign 0.43
R1574:Myh13 UTSW 11 67,253,407 (GRCm39) unclassified probably benign
R1673:Myh13 UTSW 11 67,242,945 (GRCm39) missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67,232,310 (GRCm39) missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67,225,402 (GRCm39) missense probably benign
R2029:Myh13 UTSW 11 67,252,115 (GRCm39) missense probably benign 0.03
R2030:Myh13 UTSW 11 67,241,064 (GRCm39) missense probably benign
R2247:Myh13 UTSW 11 67,225,384 (GRCm39) missense probably damaging 0.96
R2393:Myh13 UTSW 11 67,231,184 (GRCm39) missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67,255,748 (GRCm39) missense probably benign 0.12
R2884:Myh13 UTSW 11 67,228,469 (GRCm39) missense probably benign 0.27
R3696:Myh13 UTSW 11 67,235,870 (GRCm39) missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67,218,014 (GRCm39) missense probably benign 0.01
R3875:Myh13 UTSW 11 67,249,020 (GRCm39) missense probably benign 0.26
R3918:Myh13 UTSW 11 67,220,064 (GRCm39) missense probably benign 0.00
R4061:Myh13 UTSW 11 67,221,715 (GRCm39) missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67,255,636 (GRCm39) intron probably benign
R4183:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67,235,707 (GRCm39) splice site probably null
R4639:Myh13 UTSW 11 67,232,377 (GRCm39) missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67,255,564 (GRCm39) nonsense probably null
R4783:Myh13 UTSW 11 67,232,096 (GRCm39) missense probably damaging 1.00
R4877:Myh13 UTSW 11 67,228,477 (GRCm39) missense probably damaging 0.99
R5250:Myh13 UTSW 11 67,218,085 (GRCm39) nonsense probably null
R5278:Myh13 UTSW 11 67,225,390 (GRCm39) missense probably benign 0.00
R5371:Myh13 UTSW 11 67,235,616 (GRCm39) splice site probably null
R5479:Myh13 UTSW 11 67,239,648 (GRCm39) missense probably damaging 0.97
R5510:Myh13 UTSW 11 67,228,549 (GRCm39) missense probably benign 0.05
R5690:Myh13 UTSW 11 67,220,101 (GRCm39) missense probably damaging 1.00
R5797:Myh13 UTSW 11 67,225,828 (GRCm39) missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R5877:Myh13 UTSW 11 67,244,484 (GRCm39) missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67,255,556 (GRCm39) missense probably damaging 1.00
R6175:Myh13 UTSW 11 67,245,588 (GRCm39) missense probably benign 0.00
R6244:Myh13 UTSW 11 67,253,327 (GRCm39) missense probably benign 0.00
R6454:Myh13 UTSW 11 67,241,191 (GRCm39) missense probably benign 0.03
R6617:Myh13 UTSW 11 67,252,226 (GRCm39) missense probably benign 0.00
R6707:Myh13 UTSW 11 67,241,086 (GRCm39) missense probably damaging 1.00
R6747:Myh13 UTSW 11 67,241,245 (GRCm39) missense probably damaging 0.99
R6823:Myh13 UTSW 11 67,246,984 (GRCm39) missense probably benign
R6911:Myh13 UTSW 11 67,245,753 (GRCm39) nonsense probably null
R6997:Myh13 UTSW 11 67,217,980 (GRCm39) nonsense probably null
R7033:Myh13 UTSW 11 67,260,142 (GRCm39) missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67,245,566 (GRCm39) missense probably benign 0.08
R7232:Myh13 UTSW 11 67,239,672 (GRCm39) missense probably damaging 1.00
R7428:Myh13 UTSW 11 67,223,390 (GRCm39) missense probably damaging 1.00
R7448:Myh13 UTSW 11 67,255,286 (GRCm39) critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67,258,537 (GRCm39) missense
R7474:Myh13 UTSW 11 67,217,990 (GRCm39) missense possibly damaging 0.93
R7809:Myh13 UTSW 11 67,241,167 (GRCm39) missense probably benign 0.14
R7813:Myh13 UTSW 11 67,218,056 (GRCm39) missense probably benign 0.27
R7953:Myh13 UTSW 11 67,231,206 (GRCm39) missense probably damaging 1.00
R8085:Myh13 UTSW 11 67,225,613 (GRCm39) missense probably benign 0.00
R8397:Myh13 UTSW 11 67,241,113 (GRCm39) missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67,254,011 (GRCm39) critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67,255,351 (GRCm39) missense probably damaging 0.98
R8676:Myh13 UTSW 11 67,233,311 (GRCm39) missense probably damaging 1.00
R8681:Myh13 UTSW 11 67,242,960 (GRCm39) missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67,255,432 (GRCm39) missense probably benign 0.00
R9088:Myh13 UTSW 11 67,242,885 (GRCm39) missense probably damaging 1.00
R9151:Myh13 UTSW 11 67,252,149 (GRCm39) missense probably damaging 1.00
R9154:Myh13 UTSW 11 67,253,318 (GRCm39) missense probably benign
R9182:Myh13 UTSW 11 67,228,579 (GRCm39) missense probably damaging 1.00
R9332:Myh13 UTSW 11 67,254,109 (GRCm39) missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67,242,894 (GRCm39) missense probably benign
R9446:Myh13 UTSW 11 67,255,325 (GRCm39) missense probably benign 0.01
R9474:Myh13 UTSW 11 67,255,712 (GRCm39) missense
R9690:Myh13 UTSW 11 67,249,194 (GRCm39) missense probably damaging 1.00
R9761:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R9778:Myh13 UTSW 11 67,249,016 (GRCm39) missense probably damaging 0.98
Z1176:Myh13 UTSW 11 67,220,121 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,255,417 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,241,278 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAAGAATGTGCCGGTCTGTG -3'
(R):5'- TAAGCTACCCACCTTGCATCAG -3'

Sequencing Primer
(F):5'- TTTAACGAAATCAAAGCCAAGGATG -3'
(R):5'- TGCATCAGCCTCCCTCGAG -3'
Posted On 2019-11-26