Mutagenetix > Incidental Mutations

Incidental Mutation 'R7766:Plxnb2'

598258

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R7766 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89161271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1028 (S1028P)

Ref Sequence

ENSEMBL: ENSMUSP00000051731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: S1028P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: S1028P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: S1028P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: S1028P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Meta Mutation Damage Score

0.0721

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,638,341	F58S	probably benign	Het
Abca2	T	A	2: 25,441,528	M1309K	probably benign	Het
Ascc1	A	T	10: 60,004,819	M1L	probably damaging	Het
Ccdc85b	A	T	19: 5,456,852	S182R	probably damaging	Het
Cnpy3	G	T	17: 46,737,235	Q185K	possibly damaging	Het
Cyp3a41a	A	G	5: 145,718,017	Y25H	probably damaging	Het
Dscam	A	T	16: 96,790,901	F725I	probably benign	Het
Duox1	T	C	2: 122,337,301	F1022L	probably benign	Het
Ednrb	A	G	14: 103,843,289	L63P	probably benign	Het
Egr4	C	T	6: 85,512,199	G293D	probably damaging	Het
Fv1	T	A	4: 147,869,270	F98I	possibly damaging	Het
Gfm2	C	T	13: 97,150,400	S169F	probably damaging	Het
Gm13089	T	A	4: 143,699,239	I45F	probably damaging	Het
Hexim2	C	G	11: 103,139,012	P297A	probably benign	Het
Hnrnpab	G	A	11: 51,601,466	T314I	unknown	Het
Ift88	T	C	14: 57,447,654	F309S	possibly damaging	Het
Ins2	T	A	7: 142,678,757	T97S	probably benign	Het
Itga2	T	C	13: 114,853,891	I905V	probably benign	Het
Itgb8	T	C	12: 119,163,359	Y720C	probably damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kcna6	T	A	6: 126,739,719	D69V	probably damaging	Het
Kcp	A	G	6: 29,496,847	C588R	probably damaging	Het
Lrrc17	A	T	5: 21,561,044	T175S	probably benign	Het
Morc2b	A	T	17: 33,138,423	M125K	probably benign	Het
Ms4a4b	A	C	19: 11,449,988	M24L	probably benign	Het
Myh13	A	C	11: 67,358,329	S1292R	probably benign	Het
Nat10	T	C	2: 103,725,707	D923G	probably benign	Het
Nelfcd	G	A	2: 174,426,832	A559T	possibly damaging	Het
Nipbl	T	C	15: 8,296,849	I2425M	probably benign	Het
Oasl1	G	T	5: 114,937,110	A410S	probably damaging	Het
Olfr1015	T	A	2: 85,785,658	I49N	probably damaging	Het
Olfr508	C	T	7: 108,630,376	S128F	probably benign	Het
Olfr646	T	A	7: 104,106,994	C238*	probably null	Het
Padi6	T	C	4: 140,730,975	K507E	probably benign	Het
Pdcl2	T	C	5: 76,317,896	N159S	probably benign	Het
Pla2g4a	T	C	1: 149,861,058	K445E	probably benign	Het
Polb	T	C	8: 22,653,091	S30G	probably benign	Het
Slc17a6	A	T	7: 51,669,166	I519F	probably benign	Het
Tacc2	C	T	7: 130,743,598	H2582Y	probably damaging	Het
Tmem176a	A	T	6: 48,844,182		probably null	Het
Tnr	A	T	1: 159,888,310	T881S	probably benign	Het
Trp63	A	T	16: 25,868,219	R394S	probably damaging	Het
Tsga8	A	G	X: 83,487,098	L135P	unknown	Het
Ttn	T	C	2: 76,814,698	T12938A	probably damaging	Het
Ugt2b35	A	T	5: 87,001,202	D104V	possibly damaging	Het
Usp28	T	C	9: 49,035,883	S835P	probably damaging	Het
Vmn2r44	A	T	7: 8,368,220	V609E	probably damaging	Het
Zfp180	A	G	7: 24,104,659	S168G	probably benign	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGGTGTCGTTGTAGAACACG -3'
(R):5'- ATGCACATTTACCACCCTGC -3'

Sequencing Primer
(F):5'- GTCGTTGTAGAACACGTACTCCATG -3'
(R):5'- ATGCCACTTCCTGCCTGGG -3'

Posted On

2019-11-26