Incidental Mutation 'R7766:Kank1'
ID598265
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7766 (G1)
Quality Score217.468
Status Not validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCGAACG to GCG at 25411205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect probably null
Transcript: ENSMUST00000049400
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146647
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,638,341 F58S probably benign Het
Abca2 T A 2: 25,441,528 M1309K probably benign Het
Ascc1 A T 10: 60,004,819 M1L probably damaging Het
Ccdc85b A T 19: 5,456,852 S182R probably damaging Het
Cnpy3 G T 17: 46,737,235 Q185K possibly damaging Het
Cyp3a41a A G 5: 145,718,017 Y25H probably damaging Het
Dscam A T 16: 96,790,901 F725I probably benign Het
Duox1 T C 2: 122,337,301 F1022L probably benign Het
Ednrb A G 14: 103,843,289 L63P probably benign Het
Egr4 C T 6: 85,512,199 G293D probably damaging Het
Fv1 T A 4: 147,869,270 F98I possibly damaging Het
Gfm2 C T 13: 97,150,400 S169F probably damaging Het
Gm13089 T A 4: 143,699,239 I45F probably damaging Het
Hexim2 C G 11: 103,139,012 P297A probably benign Het
Hnrnpab G A 11: 51,601,466 T314I unknown Het
Ift88 T C 14: 57,447,654 F309S possibly damaging Het
Ins2 T A 7: 142,678,757 T97S probably benign Het
Itga2 T C 13: 114,853,891 I905V probably benign Het
Itgb8 T C 12: 119,163,359 Y720C probably damaging Het
Kcna6 T A 6: 126,739,719 D69V probably damaging Het
Kcp A G 6: 29,496,847 C588R probably damaging Het
Lrrc17 A T 5: 21,561,044 T175S probably benign Het
Morc2b A T 17: 33,138,423 M125K probably benign Het
Ms4a4b A C 19: 11,449,988 M24L probably benign Het
Myh13 A C 11: 67,358,329 S1292R probably benign Het
Nat10 T C 2: 103,725,707 D923G probably benign Het
Nelfcd G A 2: 174,426,832 A559T possibly damaging Het
Nipbl T C 15: 8,296,849 I2425M probably benign Het
Oasl1 G T 5: 114,937,110 A410S probably damaging Het
Olfr1015 T A 2: 85,785,658 I49N probably damaging Het
Olfr508 C T 7: 108,630,376 S128F probably benign Het
Olfr646 T A 7: 104,106,994 C238* probably null Het
Padi6 T C 4: 140,730,975 K507E probably benign Het
Pdcl2 T C 5: 76,317,896 N159S probably benign Het
Pla2g4a T C 1: 149,861,058 K445E probably benign Het
Plxnb2 A G 15: 89,161,271 S1028P probably benign Het
Polb T C 8: 22,653,091 S30G probably benign Het
Slc17a6 A T 7: 51,669,166 I519F probably benign Het
Tacc2 C T 7: 130,743,598 H2582Y probably damaging Het
Tnr A T 1: 159,888,310 T881S probably benign Het
Trp63 A T 16: 25,868,219 R394S probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Ttn T C 2: 76,814,698 T12938A probably damaging Het
Ugt2b35 A T 5: 87,001,202 D104V possibly damaging Het
Usp28 T C 9: 49,035,883 S835P probably damaging Het
Vmn2r44 A T 7: 8,368,220 V609E probably damaging Het
Zfp180 A G 7: 24,104,659 S168G probably benign Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1681:Kank1 UTSW 19 25410304 missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R3153:Kank1 UTSW 19 25410688 missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25411072 missense probably benign 0.10
R4670:Kank1 UTSW 19 25410580 missense probably benign 0.00
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5189:Kank1 UTSW 19 25424181 missense probably damaging 1.00
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25430341 missense probably damaging 1.00
R7405:Kank1 UTSW 19 25410319 nonsense probably null
R7486:Kank1 UTSW 19 25410829 missense probably damaging 0.99
R7602:Kank1 UTSW 19 25422161 missense probably benign 0.01
R7701:Kank1 UTSW 19 25411765 critical splice donor site probably null
R7765:Kank1 UTSW 19 25411205 frame shift probably null
R7768:Kank1 UTSW 19 25411205 frame shift probably null
R8020:Kank1 UTSW 19 25411205 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTGTCTGCTTCCCCAAGGAG -3'
(R):5'- TCCGCATTTTGAGACCAACTAG -3'

Sequencing Primer
(F):5'- TGCTTCCCCAAGGAGTGCAC -3'
(R):5'- CAGAATTGCCAGACAGCA -3'
Posted On2019-11-26