Mutagenetix > Incidental Mutation

Incidental Mutation 'R7767:Rasef'

598282

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R7767 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73734534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 577 (S577P)

Ref Sequence

ENSEMBL: ENSMUSP00000152127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably damaging
Transcript: ENSMUST00000058292
AA Change: S496P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: S496P

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102837
AA Change: S424P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: S424P

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000222414
AA Change: S577P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	G	T	3: 36,920,287		probably null	Het
Aox4	C	A	1: 58,235,207	S384Y	probably damaging	Het
Arhgef15	T	C	11: 68,953,847	E308G	probably damaging	Het
Asb15	A	G	6: 24,559,282	D142G	probably benign	Het
Atg13	A	G	2: 91,679,366	S394P	probably damaging	Het
Atp10a	G	C	7: 58,658,849	W132S	probably damaging	Het
BC003331	A	G	1: 150,372,037	V387A	probably benign	Het
Bod1l	T	A	5: 41,816,756	N2405I	probably benign	Het
Capsl	C	T	15: 9,462,684	R137C	probably damaging	Het
Cd109	T	A	9: 78,710,159	M1313K	probably damaging	Het
Chst13	G	A	6: 90,309,584	A132V	possibly damaging	Het
Cobl	T	C	11: 12,412,117		probably benign	Het
Coq9	A	T	8: 94,850,586	E193V	probably benign	Het
Cpd	T	A	11: 76,813,559	I410F	probably benign	Het
Cyth3	T	G	5: 143,707,474	V351G	probably damaging	Het
Dcdc2c	T	C	12: 28,470,257	K607E		Het
Dcp1a	T	C	14: 30,479,818		probably null	Het
Dennd3	A	G	15: 73,522,230	I35V	probably benign	Het
Dlgap4	C	T	2: 156,746,053	R606W	probably damaging	Het
Dnhd1	A	G	7: 105,694,610	I1720M	probably benign	Het
Erbin	A	G	13: 103,859,399	L265P	probably damaging	Het
Ern1	T	C	11: 106,400,308	D847G	probably damaging	Het
Esyt3	T	G	9: 99,324,971	S342R	probably benign	Het
Exoc2	A	T	13: 30,876,769	I584K	probably benign	Het
Fam240a	T	C	9: 110,915,022	R50G	probably damaging	Het
Glis3	A	T	19: 28,263,960	M858K	probably benign	Het
Gls2	C	T	10: 128,195,129	R86C	unknown	Het
Gm10972	C	A	3: 94,643,594	Y25*	probably null	Het
H2-T10	A	T	17: 36,117,730	M350K	probably benign	Het
Has1	A	T	17: 17,850,530	V43D	probably damaging	Het
Herc2	T	A	7: 56,228,527	S4609R	probably benign	Het
Hmgcs2	A	C	3: 98,291,266	T162P	probably damaging	Het
Hspg2	G	T	4: 137,511,866	C368F	probably damaging	Het
Ighv11-1	A	G	12: 113,982,102	S44P	probably damaging	Het
Inppl1	A	G	7: 101,824,338	V1035A	probably benign	Het
Kmt2a	C	T	9: 44,818,998	V3341I	unknown	Het
Lrp1b	T	C	2: 40,801,505	N3434S		Het
Lrriq1	G	C	10: 103,215,954	S312R	probably damaging	Het
Map1a	G	A	2: 121,302,036	S1111N	probably damaging	Het
Myo15	T	C	11: 60,502,096	V1029A		Het
Nol11	T	C	11: 107,179,082	H314R	possibly damaging	Het
Nphs1	A	T	7: 30,463,308	D404V	probably damaging	Het
Olfr550	A	T	7: 102,571,764		probably benign	Het
Pabpc2	T	C	18: 39,774,554	Y291H	possibly damaging	Het
Pcdh15	G	A	10: 74,486,256	A1020T	probably benign	Het
Pla2g4f	A	C	2: 120,305,009	S395A	possibly damaging	Het
Ppp1r18	A	G	17: 35,867,284	Q17R	probably damaging	Het
Prokr2	A	T	2: 132,374,076	V155D	probably damaging	Het
Pwwp2a	T	G	11: 43,705,869	C620W	probably damaging	Het
Rabepk	T	C	2: 34,785,593	D175G	probably damaging	Het
Rad54l	T	C	4: 116,099,669	Y485C	probably damaging	Het
Rgma	C	A	7: 73,418,004	L446I	unknown	Het
Rnf212b	T	C	14: 54,842,368	S182P	probably damaging	Het
Rnf6	C	A	5: 146,211,176	R344I	probably damaging	Het
Rnf6	T	A	5: 146,211,177	R344*	probably null	Het
Sgo1	A	G	17: 53,679,611	I184T	possibly damaging	Het
Sgpl1	A	T	10: 61,117,723	I78N	possibly damaging	Het
Snx13	T	A	12: 35,107,484	Y510N	probably damaging	Het
Sptbn2	G	A	19: 4,734,143	E638K	possibly damaging	Het
Sspo	A	G	6: 48,451,382	T349A	probably damaging	Het
Sv2c	C	T	13: 95,989,715	S343N	probably damaging	Het
Syne1	C	A	10: 5,333,560	V1502F	possibly damaging	Het
Syne1	T	A	10: 5,333,632	I1478F	possibly damaging	Het
Tmem121	C	T	12: 113,188,372	A70V	probably damaging	Het
Tmem215	A	G	4: 40,474,042	I40V	possibly damaging	Het
Trim25	A	G	11: 89,009,117		probably null	Het
Trio	A	G	15: 27,889,418	V534A	unknown	Het
Tyr	T	A	7: 87,493,010	E114V	probably benign	Het
Ush2a	A	T	1: 188,553,260	T1998S	probably benign	Het
Usp40	G	T	1: 87,982,178	A518E	probably benign	Het
Usp48	T	A	4: 137,604,645		probably null	Het
Vash1	T	A	12: 86,686,993	F152L	probably damaging	Het
Vsig10l	C	A	7: 43,463,717	P31Q	probably damaging	Het
Xab2	C	T	8: 3,619,018	E43K	probably benign	Het
Zfp423	G	A	8: 87,780,884	S944F	probably damaging	Het
Zp2	A	T	7: 120,137,169	D350E	probably benign	Het
Zscan4e	T	G	7: 11,307,534	Q165P	probably damaging	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- ACTAGCGCCTAATCATCCGG -3'
(R):5'- ACATTCTTGGGATTGTCTGGAC -3'

Sequencing Primer
(F):5'- GCACAAAGCTGGATCTCTTG -3'
(R):5'- CTGGACAAAGGATAGGCTTCTTC -3'

Posted On

2019-11-26