Incidental Mutation 'R7767:Cpd'
ID598321
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Namecarboxypeptidase D
SynonymsD830034L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R7767 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location76778424-76847018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76813559 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 410 (I410F)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
Predicted Effect probably benign
Transcript: ENSMUST00000021201
AA Change: I410F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: I410F

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,920,287 probably null Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Arhgef15 T C 11: 68,953,847 E308G probably damaging Het
Asb15 A G 6: 24,559,282 D142G probably benign Het
Atg13 A G 2: 91,679,366 S394P probably damaging Het
Atp10a G C 7: 58,658,849 W132S probably damaging Het
BC003331 A G 1: 150,372,037 V387A probably benign Het
Bod1l T A 5: 41,816,756 N2405I probably benign Het
Capsl C T 15: 9,462,684 R137C probably damaging Het
Cd109 T A 9: 78,710,159 M1313K probably damaging Het
Chst13 G A 6: 90,309,584 A132V possibly damaging Het
Cobl T C 11: 12,412,117 probably benign Het
Coq9 A T 8: 94,850,586 E193V probably benign Het
Cyth3 T G 5: 143,707,474 V351G probably damaging Het
Dcdc2c T C 12: 28,470,257 K607E Het
Dcp1a T C 14: 30,479,818 probably null Het
Dennd3 A G 15: 73,522,230 I35V probably benign Het
Dlgap4 C T 2: 156,746,053 R606W probably damaging Het
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Erbin A G 13: 103,859,399 L265P probably damaging Het
Ern1 T C 11: 106,400,308 D847G probably damaging Het
Esyt3 T G 9: 99,324,971 S342R probably benign Het
Exoc2 A T 13: 30,876,769 I584K probably benign Het
Fam240a T C 9: 110,915,022 R50G probably damaging Het
Glis3 A T 19: 28,263,960 M858K probably benign Het
Gls2 C T 10: 128,195,129 R86C unknown Het
Gm10972 C A 3: 94,643,594 Y25* probably null Het
H2-T10 A T 17: 36,117,730 M350K probably benign Het
Has1 A T 17: 17,850,530 V43D probably damaging Het
Herc2 T A 7: 56,228,527 S4609R probably benign Het
Hmgcs2 A C 3: 98,291,266 T162P probably damaging Het
Hspg2 G T 4: 137,511,866 C368F probably damaging Het
Ighv11-1 A G 12: 113,982,102 S44P probably damaging Het
Inppl1 A G 7: 101,824,338 V1035A probably benign Het
Kmt2a C T 9: 44,818,998 V3341I unknown Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrriq1 G C 10: 103,215,954 S312R probably damaging Het
Map1a G A 2: 121,302,036 S1111N probably damaging Het
Myo15 T C 11: 60,502,096 V1029A Het
Nol11 T C 11: 107,179,082 H314R possibly damaging Het
Nphs1 A T 7: 30,463,308 D404V probably damaging Het
Olfr550 A T 7: 102,571,764 probably benign Het
Pabpc2 T C 18: 39,774,554 Y291H possibly damaging Het
Pcdh15 G A 10: 74,486,256 A1020T probably benign Het
Pla2g4f A C 2: 120,305,009 S395A possibly damaging Het
Ppp1r18 A G 17: 35,867,284 Q17R probably damaging Het
Prokr2 A T 2: 132,374,076 V155D probably damaging Het
Pwwp2a T G 11: 43,705,869 C620W probably damaging Het
Rabepk T C 2: 34,785,593 D175G probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Rgma C A 7: 73,418,004 L446I unknown Het
Rnf212b T C 14: 54,842,368 S182P probably damaging Het
Rnf6 T A 5: 146,211,177 R344* probably null Het
Rnf6 C A 5: 146,211,176 R344I probably damaging Het
Sgo1 A G 17: 53,679,611 I184T possibly damaging Het
Sgpl1 A T 10: 61,117,723 I78N possibly damaging Het
Snx13 T A 12: 35,107,484 Y510N probably damaging Het
Sptbn2 G A 19: 4,734,143 E638K possibly damaging Het
Sspo A G 6: 48,451,382 T349A probably damaging Het
Sv2c C T 13: 95,989,715 S343N probably damaging Het
Syne1 C A 10: 5,333,560 V1502F possibly damaging Het
Syne1 T A 10: 5,333,632 I1478F possibly damaging Het
Tmem121 C T 12: 113,188,372 A70V probably damaging Het
Tmem215 A G 4: 40,474,042 I40V possibly damaging Het
Trim25 A G 11: 89,009,117 probably null Het
Trio A G 15: 27,889,418 V534A unknown Het
Tyr T A 7: 87,493,010 E114V probably benign Het
Ush2a A T 1: 188,553,260 T1998S probably benign Het
Usp40 G T 1: 87,982,178 A518E probably benign Het
Usp48 T A 4: 137,604,645 probably null Het
Vash1 T A 12: 86,686,993 F152L probably damaging Het
Vsig10l C A 7: 43,463,717 P31Q probably damaging Het
Xab2 C T 8: 3,619,018 E43K probably benign Het
Zfp423 G A 8: 87,780,884 S944F probably damaging Het
Zp2 A T 7: 120,137,169 D350E probably benign Het
Zscan4e T G 7: 11,307,534 Q165P probably damaging Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGCCCCATTCAGTGAG -3'
(R):5'- GTCTATACTTTGTTTCAACTTCAAGGG -3'

Sequencing Primer
(F):5'- GTGAGAAGCACTTAGACAATCCTAC -3'
(R):5'- TTCCATAAAGGGTTCCAGGGC -3'
Posted On2019-11-26