Incidental Mutation 'R7767:Exoc2'
ID 598330
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R7767 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30876769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 584 (I584K)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: I584K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: I584K

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: I584K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: I584K

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,920,287 probably null Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Arhgef15 T C 11: 68,953,847 E308G probably damaging Het
Asb15 A G 6: 24,559,282 D142G probably benign Het
Atg13 A G 2: 91,679,366 S394P probably damaging Het
Atp10a G C 7: 58,658,849 W132S probably damaging Het
BC003331 A G 1: 150,372,037 V387A probably benign Het
Bod1l T A 5: 41,816,756 N2405I probably benign Het
Capsl C T 15: 9,462,684 R137C probably damaging Het
Cd109 T A 9: 78,710,159 M1313K probably damaging Het
Chst13 G A 6: 90,309,584 A132V possibly damaging Het
Cobl T C 11: 12,412,117 probably benign Het
Coq9 A T 8: 94,850,586 E193V probably benign Het
Cpd T A 11: 76,813,559 I410F probably benign Het
Cyth3 T G 5: 143,707,474 V351G probably damaging Het
Dcdc2c T C 12: 28,470,257 K607E Het
Dcp1a T C 14: 30,479,818 probably null Het
Dennd3 A G 15: 73,522,230 I35V probably benign Het
Dlgap4 C T 2: 156,746,053 R606W probably damaging Het
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Erbin A G 13: 103,859,399 L265P probably damaging Het
Ern1 T C 11: 106,400,308 D847G probably damaging Het
Esyt3 T G 9: 99,324,971 S342R probably benign Het
Fam240a T C 9: 110,915,022 R50G probably damaging Het
Glis3 A T 19: 28,263,960 M858K probably benign Het
Gls2 C T 10: 128,195,129 R86C unknown Het
Gm10972 C A 3: 94,643,594 Y25* probably null Het
H2-T10 A T 17: 36,117,730 M350K probably benign Het
Has1 A T 17: 17,850,530 V43D probably damaging Het
Herc2 T A 7: 56,228,527 S4609R probably benign Het
Hmgcs2 A C 3: 98,291,266 T162P probably damaging Het
Hspg2 G T 4: 137,511,866 C368F probably damaging Het
Ighv11-1 A G 12: 113,982,102 S44P probably damaging Het
Inppl1 A G 7: 101,824,338 V1035A probably benign Het
Kmt2a C T 9: 44,818,998 V3341I unknown Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrriq1 G C 10: 103,215,954 S312R probably damaging Het
Map1a G A 2: 121,302,036 S1111N probably damaging Het
Myo15 T C 11: 60,502,096 V1029A Het
Nol11 T C 11: 107,179,082 H314R possibly damaging Het
Nphs1 A T 7: 30,463,308 D404V probably damaging Het
Olfr550 A T 7: 102,571,764 probably benign Het
Pabpc2 T C 18: 39,774,554 Y291H possibly damaging Het
Pcdh15 G A 10: 74,486,256 A1020T probably benign Het
Pla2g4f A C 2: 120,305,009 S395A possibly damaging Het
Ppp1r18 A G 17: 35,867,284 Q17R probably damaging Het
Prokr2 A T 2: 132,374,076 V155D probably damaging Het
Pwwp2a T G 11: 43,705,869 C620W probably damaging Het
Rabepk T C 2: 34,785,593 D175G probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Rgma C A 7: 73,418,004 L446I unknown Het
Rnf212b T C 14: 54,842,368 S182P probably damaging Het
Rnf6 C A 5: 146,211,176 R344I probably damaging Het
Rnf6 T A 5: 146,211,177 R344* probably null Het
Sgo1 A G 17: 53,679,611 I184T possibly damaging Het
Sgpl1 A T 10: 61,117,723 I78N possibly damaging Het
Snx13 T A 12: 35,107,484 Y510N probably damaging Het
Sptbn2 G A 19: 4,734,143 E638K possibly damaging Het
Sspo A G 6: 48,451,382 T349A probably damaging Het
Sv2c C T 13: 95,989,715 S343N probably damaging Het
Syne1 C A 10: 5,333,560 V1502F possibly damaging Het
Syne1 T A 10: 5,333,632 I1478F possibly damaging Het
Tmem121 C T 12: 113,188,372 A70V probably damaging Het
Tmem215 A G 4: 40,474,042 I40V possibly damaging Het
Trim25 A G 11: 89,009,117 probably null Het
Trio A G 15: 27,889,418 V534A unknown Het
Tyr T A 7: 87,493,010 E114V probably benign Het
Ush2a A T 1: 188,553,260 T1998S probably benign Het
Usp40 G T 1: 87,982,178 A518E probably benign Het
Usp48 T A 4: 137,604,645 probably null Het
Vash1 T A 12: 86,686,993 F152L probably damaging Het
Vsig10l C A 7: 43,463,717 P31Q probably damaging Het
Xab2 C T 8: 3,619,018 E43K probably benign Het
Zfp423 G A 8: 87,780,884 S944F probably damaging Het
Zp2 A T 7: 120,137,169 D350E probably benign Het
Zscan4e T G 7: 11,307,534 Q165P probably damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGGTGTTCTGATTTCATGTGAC -3'
(R):5'- ATGCTGTCACTCCTGAGCTC -3'

Sequencing Primer
(F):5'- ATCCACATGTTTTTAACCTGGGAC -3'
(R):5'- TCACTCCTGAGCTCCGTGAG -3'
Posted On 2019-11-26