Incidental Mutation 'R7767:Trio'
ID598336
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7767 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27889418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 534 (V534A)
Ref Sequence ENSEMBL: ENSMUSP00000087714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000227337]
Predicted Effect unknown
Transcript: ENSMUST00000090247
AA Change: V534A
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: V534A

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227337
AA Change: V475A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,920,287 probably null Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Arhgef15 T C 11: 68,953,847 E308G probably damaging Het
Asb15 A G 6: 24,559,282 D142G probably benign Het
Atg13 A G 2: 91,679,366 S394P probably damaging Het
Atp10a G C 7: 58,658,849 W132S probably damaging Het
BC003331 A G 1: 150,372,037 V387A probably benign Het
Bod1l T A 5: 41,816,756 N2405I probably benign Het
Capsl C T 15: 9,462,684 R137C probably damaging Het
Cd109 T A 9: 78,710,159 M1313K probably damaging Het
Chst13 G A 6: 90,309,584 A132V possibly damaging Het
Cobl T C 11: 12,412,117 probably benign Het
Coq9 A T 8: 94,850,586 E193V probably benign Het
Cpd T A 11: 76,813,559 I410F probably benign Het
Cyth3 T G 5: 143,707,474 V351G probably damaging Het
Dcdc2c T C 12: 28,470,257 K607E Het
Dcp1a T C 14: 30,479,818 probably null Het
Dennd3 A G 15: 73,522,230 I35V probably benign Het
Dlgap4 C T 2: 156,746,053 R606W probably damaging Het
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Erbin A G 13: 103,859,399 L265P probably damaging Het
Ern1 T C 11: 106,400,308 D847G probably damaging Het
Esyt3 T G 9: 99,324,971 S342R probably benign Het
Exoc2 A T 13: 30,876,769 I584K probably benign Het
Fam240a T C 9: 110,915,022 R50G probably damaging Het
Glis3 A T 19: 28,263,960 M858K probably benign Het
Gls2 C T 10: 128,195,129 R86C unknown Het
Gm10972 C A 3: 94,643,594 Y25* probably null Het
H2-T10 A T 17: 36,117,730 M350K probably benign Het
Has1 A T 17: 17,850,530 V43D probably damaging Het
Herc2 T A 7: 56,228,527 S4609R probably benign Het
Hmgcs2 A C 3: 98,291,266 T162P probably damaging Het
Hspg2 G T 4: 137,511,866 C368F probably damaging Het
Ighv11-1 A G 12: 113,982,102 S44P probably damaging Het
Inppl1 A G 7: 101,824,338 V1035A probably benign Het
Kmt2a C T 9: 44,818,998 V3341I unknown Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrriq1 G C 10: 103,215,954 S312R probably damaging Het
Map1a G A 2: 121,302,036 S1111N probably damaging Het
Myo15 T C 11: 60,502,096 V1029A Het
Nol11 T C 11: 107,179,082 H314R possibly damaging Het
Nphs1 A T 7: 30,463,308 D404V probably damaging Het
Olfr550 A T 7: 102,571,764 probably benign Het
Pabpc2 T C 18: 39,774,554 Y291H possibly damaging Het
Pcdh15 G A 10: 74,486,256 A1020T probably benign Het
Pla2g4f A C 2: 120,305,009 S395A possibly damaging Het
Ppp1r18 A G 17: 35,867,284 Q17R probably damaging Het
Prokr2 A T 2: 132,374,076 V155D probably damaging Het
Pwwp2a T G 11: 43,705,869 C620W probably damaging Het
Rabepk T C 2: 34,785,593 D175G probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Rgma C A 7: 73,418,004 L446I unknown Het
Rnf212b T C 14: 54,842,368 S182P probably damaging Het
Rnf6 C A 5: 146,211,176 R344I probably damaging Het
Rnf6 T A 5: 146,211,177 R344* probably null Het
Sgo1 A G 17: 53,679,611 I184T possibly damaging Het
Sgpl1 A T 10: 61,117,723 I78N possibly damaging Het
Snx13 T A 12: 35,107,484 Y510N probably damaging Het
Sptbn2 G A 19: 4,734,143 E638K possibly damaging Het
Sspo A G 6: 48,451,382 T349A probably damaging Het
Sv2c C T 13: 95,989,715 S343N probably damaging Het
Syne1 C A 10: 5,333,560 V1502F possibly damaging Het
Syne1 T A 10: 5,333,632 I1478F possibly damaging Het
Tmem121 C T 12: 113,188,372 A70V probably damaging Het
Tmem215 A G 4: 40,474,042 I40V possibly damaging Het
Trim25 A G 11: 89,009,117 probably null Het
Tyr T A 7: 87,493,010 E114V probably benign Het
Ush2a A T 1: 188,553,260 T1998S probably benign Het
Usp40 G T 1: 87,982,178 A518E probably benign Het
Usp48 T A 4: 137,604,645 probably null Het
Vash1 T A 12: 86,686,993 F152L probably damaging Het
Vsig10l C A 7: 43,463,717 P31Q probably damaging Het
Xab2 C T 8: 3,619,018 E43K probably benign Het
Zfp423 G A 8: 87,780,884 S944F probably damaging Het
Zp2 A T 7: 120,137,169 D350E probably benign Het
Zscan4e T G 7: 11,307,534 Q165P probably damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACAGTCAGAAGCCAGAG -3'
(R):5'- ATATACCTGTGCTGGCATGTG -3'

Sequencing Primer
(F):5'- GTCAGAAGCCAGAGCCCAC -3'
(R):5'- CATGTGGTTGTGTGTAGCATAC -3'
Posted On2019-11-26