Incidental Mutation 'R7768:Usp8'
ID598355
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7768 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126751123 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 766 (Q766R)
Ref Sequence ENSEMBL: ENSMUSP00000106046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect probably damaging
Transcript: ENSMUST00000028841
AA Change: Q755R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: Q755R

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110416
AA Change: Q766R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: Q766R

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Acy1 G A 9: 106,433,618 T317M possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dmxl2 T C 9: 54,380,939 Y2628C probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd1l2 A G 8: 117,054,860 probably null Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Psg18 A T 7: 18,346,028 I416N probably damaging Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc33a1 A G 3: 63,947,618 F407S possibly damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Smchd1 C T 17: 71,411,911 G821D probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4074:Usp8 UTSW 2 126752370 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5625:Usp8 UTSW 2 126742277 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6529:Usp8 UTSW 2 126725378 missense probably benign 0.01
R6551:Usp8 UTSW 2 126733182 intron probably benign
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
R8097:Usp8 UTSW 2 126754880 missense probably benign 0.44
R8130:Usp8 UTSW 2 126717998 intron probably benign
Z1177:Usp8 UTSW 2 126758431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTCAGCAGTTTAGCCTG -3'
(R):5'- AGTCTGGCATGTTGTAACCATAC -3'

Sequencing Primer
(F):5'- ATCTTCATGTGGACCCAGCTTGAG -3'
(R):5'- TGTAACCATACAAAACTCGAGTACTG -3'
Posted On2019-11-26