Incidental Mutation 'R7768:Slc6a6'
ID 598375
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 045824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91716946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 274 (I274N)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
AlphaFold O35316
Predicted Effect probably damaging
Transcript: ENSMUST00000032185
AA Change: I274N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: I274N

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 A G 13: 12,297,480 (GRCm39) V479A possibly damaging Het
Acy1 G A 9: 106,310,817 (GRCm39) T317M possibly damaging Het
Adgrg6 A T 10: 14,307,410 (GRCm39) D797E probably benign Het
Ank1 C T 8: 23,588,013 (GRCm39) A552V probably benign Het
Ankrd13c A G 3: 157,694,284 (GRCm39) T262A probably benign Het
Ap4e1 A T 2: 126,888,854 (GRCm39) N468Y probably damaging Het
Apbb1 T C 7: 105,216,295 (GRCm39) I367V probably benign Het
Arl6 A G 16: 59,452,699 (GRCm39) I33T probably damaging Het
Asgr2 T C 11: 69,996,242 (GRCm39) I228T probably damaging Het
Aspn A G 13: 49,710,871 (GRCm39) H172R probably damaging Het
Bclaf1 T A 10: 20,215,517 (GRCm39) F868L probably benign Het
Cacna1i G A 15: 80,265,389 (GRCm39) R1547H probably damaging Het
Celsr1 G T 15: 85,816,610 (GRCm39) Q1778K probably benign Het
Cep250 T C 2: 155,827,929 (GRCm39) L42S Het
Clnk C A 5: 38,925,501 (GRCm39) R100L probably damaging Het
Cpvl A G 6: 53,873,476 (GRCm39) V420A possibly damaging Het
Dicer1 C A 12: 104,672,956 (GRCm39) G825V probably damaging Het
Dmxl2 T C 9: 54,288,223 (GRCm39) Y2628C probably damaging Het
Dnah7b T A 1: 46,176,634 (GRCm39) H751Q probably benign Het
Dnhd1 C A 7: 105,370,302 (GRCm39) R4576S possibly damaging Het
Dzip1 A T 14: 119,116,910 (GRCm39) D775E probably benign Het
Erich3 T A 3: 154,453,968 (GRCm39) M381K probably benign Het
Fam193a A G 5: 34,623,135 (GRCm39) D1241G possibly damaging Het
Gbx2 A G 1: 89,856,706 (GRCm39) L228P probably benign Het
Ggt7 A T 2: 155,348,421 (GRCm39) M77K possibly damaging Het
Gpr26 T A 7: 131,576,077 (GRCm39) I247K probably damaging Het
Grip1 A G 10: 119,874,302 (GRCm39) T745A probably damaging Het
Gusb A T 5: 130,029,246 (GRCm39) H178Q probably benign Het
Hacl1 T C 14: 31,338,437 (GRCm39) Y380C probably damaging Het
Hdac9 T C 12: 34,440,239 (GRCm39) H380R possibly damaging Het
Icam4 T A 9: 20,941,290 (GRCm39) L143Q probably damaging Het
Ikbkb T A 8: 23,185,252 (GRCm39) I43F probably damaging Het
Ints11 G T 4: 155,971,396 (GRCm39) K303N probably damaging Het
Itpa A T 2: 130,509,836 (GRCm39) N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kat6a T A 8: 23,393,228 (GRCm39) N235K probably damaging Het
Kmt2a C T 9: 44,731,900 (GRCm39) V2806I unknown Het
Loxhd1 T A 18: 77,472,637 (GRCm39) F1051L probably damaging Het
Map2 A G 1: 66,453,642 (GRCm39) E844G possibly damaging Het
Mmp7 T A 9: 7,697,749 (GRCm39) Y261* probably null Het
Muc4 A C 16: 32,576,568 (GRCm39) M2023L unknown Het
Mybpc1 C A 10: 88,378,234 (GRCm39) G688V probably damaging Het
Myo3a A G 2: 22,245,954 (GRCm39) T34A probably damaging Het
Nrxn2 A G 19: 6,531,409 (GRCm39) T683A possibly damaging Het
Nup160 A G 2: 90,530,460 (GRCm39) I444V probably damaging Het
Or2t29 A T 11: 58,433,466 (GRCm39) S292T probably damaging Het
Or2t29 A T 11: 58,433,693 (GRCm39) M216K possibly damaging Het
Or4f4-ps1 A C 2: 111,330,198 (GRCm39) K200N possibly damaging Het
Or8w1 T C 2: 87,465,657 (GRCm39) M145V probably benign Het
Pcdha1 A G 18: 37,065,220 (GRCm39) E628G probably damaging Het
Pcdha12 T C 18: 37,155,404 (GRCm39) S708P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd1l2 A G 8: 117,781,599 (GRCm39) probably null Het
Pla2g6 T C 15: 79,181,514 (GRCm39) D577G probably damaging Het
Pla2r1 G T 2: 60,279,290 (GRCm39) D763E probably benign Het
Pramel18 A C 4: 101,769,010 (GRCm39) I454L probably benign Het
Psg18 A T 7: 18,079,953 (GRCm39) I416N probably damaging Het
Rapgef6 G T 11: 54,517,414 (GRCm39) V369F probably damaging Het
Rasal3 T C 17: 32,615,767 (GRCm39) E357G probably damaging Het
Rhbdl3 G A 11: 80,221,447 (GRCm39) R195Q probably benign Het
Rnf216 A T 5: 143,084,199 (GRCm39) M1K probably null Het
Rspry1 C A 8: 95,356,469 (GRCm39) D165E probably damaging Het
Rwdd2b G A 16: 87,233,633 (GRCm39) L156F probably benign Het
Scn11a T A 9: 119,644,338 (GRCm39) I141F probably benign Het
Sirt2 A T 7: 28,482,284 (GRCm39) T198S probably benign Het
Slc2a1 A G 4: 118,989,644 (GRCm39) N94D probably damaging Het
Slc33a1 A G 3: 63,855,039 (GRCm39) F407S possibly damaging Het
Slc38a4 A C 15: 96,906,545 (GRCm39) L356R probably damaging Het
Slc43a1 T A 2: 84,687,215 (GRCm39) L372Q probably damaging Het
Smchd1 C T 17: 71,718,906 (GRCm39) G821D probably damaging Het
Spata33 T C 8: 123,941,146 (GRCm39) F65S unknown Het
Spmip5 A T 19: 58,781,174 (GRCm39) Y25N probably damaging Het
Stx19 A G 16: 62,642,567 (GRCm39) T128A probably benign Het
Tas2r103 T C 6: 133,013,812 (GRCm39) M85V probably benign Het
Tas2r117 C T 6: 132,780,485 (GRCm39) L208F probably damaging Het
Tcirg1 A T 19: 3,952,900 (GRCm39) I233N possibly damaging Het
Uba6 C A 5: 86,300,779 (GRCm39) W192L probably benign Het
Ube3a T C 7: 58,938,525 (GRCm39) I761T probably damaging Het
Unc80 T C 1: 66,549,754 (GRCm39) S671P possibly damaging Het
Usp8 A G 2: 126,593,043 (GRCm39) Q766R probably damaging Het
Vmn2r103 A G 17: 20,032,314 (GRCm39) N696S probably damaging Het
Vmn2r14 G A 5: 109,368,086 (GRCm39) T302I probably benign Het
Vmn2r50 G A 7: 9,771,298 (GRCm39) A801V probably damaging Het
Vmn2r85 T G 10: 130,254,562 (GRCm39) Q707H probably damaging Het
Wsb2 G A 5: 117,501,787 (GRCm39) V51M probably benign Het
Xdh T C 17: 74,246,831 (GRCm39) T78A probably benign Het
Zfp442 T C 2: 150,250,241 (GRCm39) K554E possibly damaging Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATATGTCTCTAGGGTCCTTGC -3'
(R):5'- TACTGGCCCAGGAGAGAAGTAC -3'

Sequencing Primer
(F):5'- TAGGGTCCTTGCTGCACC -3'
(R):5'- CCAGGCAGTAATGGTTGGCTAC -3'
Posted On 2019-11-26