Incidental Mutation 'R7768:Psg18'
ID 598380
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18346028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 416 (I416N)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably damaging
Transcript: ENSMUST00000003597
AA Change: I416N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: I416N

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098783
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Acy1 G A 9: 106,433,618 T317M possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dmxl2 T C 9: 54,380,939 Y2628C probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd1l2 A G 8: 117,054,860 probably null Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc33a1 A G 3: 63,947,618 F407S possibly damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Smchd1 C T 17: 71,411,911 G821D probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Usp8 A G 2: 126,751,123 Q766R probably damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGGGTCACTCATTCATCACAG -3'
(R):5'- AGTTGGCAAATGCAAAGCAC -3'

Sequencing Primer
(F):5'- GGTCACTCATTCATCACAGTCAGG -3'
(R):5'- GATATGAGTGTAGTCACAGCTCC -3'
Posted On 2019-11-26