Incidental Mutation 'R7768:Pkd1l2'
ID 598390
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms 1700126L06Rik
MMRRC Submission 045824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 117722418-117809188 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 117781599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000098375
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109093
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 A G 13: 12,297,480 (GRCm39) V479A possibly damaging Het
Acy1 G A 9: 106,310,817 (GRCm39) T317M possibly damaging Het
Adgrg6 A T 10: 14,307,410 (GRCm39) D797E probably benign Het
Ank1 C T 8: 23,588,013 (GRCm39) A552V probably benign Het
Ankrd13c A G 3: 157,694,284 (GRCm39) T262A probably benign Het
Ap4e1 A T 2: 126,888,854 (GRCm39) N468Y probably damaging Het
Apbb1 T C 7: 105,216,295 (GRCm39) I367V probably benign Het
Arl6 A G 16: 59,452,699 (GRCm39) I33T probably damaging Het
Asgr2 T C 11: 69,996,242 (GRCm39) I228T probably damaging Het
Aspn A G 13: 49,710,871 (GRCm39) H172R probably damaging Het
Bclaf1 T A 10: 20,215,517 (GRCm39) F868L probably benign Het
Cacna1i G A 15: 80,265,389 (GRCm39) R1547H probably damaging Het
Celsr1 G T 15: 85,816,610 (GRCm39) Q1778K probably benign Het
Cep250 T C 2: 155,827,929 (GRCm39) L42S Het
Clnk C A 5: 38,925,501 (GRCm39) R100L probably damaging Het
Cpvl A G 6: 53,873,476 (GRCm39) V420A possibly damaging Het
Dicer1 C A 12: 104,672,956 (GRCm39) G825V probably damaging Het
Dmxl2 T C 9: 54,288,223 (GRCm39) Y2628C probably damaging Het
Dnah7b T A 1: 46,176,634 (GRCm39) H751Q probably benign Het
Dnhd1 C A 7: 105,370,302 (GRCm39) R4576S possibly damaging Het
Dzip1 A T 14: 119,116,910 (GRCm39) D775E probably benign Het
Erich3 T A 3: 154,453,968 (GRCm39) M381K probably benign Het
Fam193a A G 5: 34,623,135 (GRCm39) D1241G possibly damaging Het
Gbx2 A G 1: 89,856,706 (GRCm39) L228P probably benign Het
Ggt7 A T 2: 155,348,421 (GRCm39) M77K possibly damaging Het
Gpr26 T A 7: 131,576,077 (GRCm39) I247K probably damaging Het
Grip1 A G 10: 119,874,302 (GRCm39) T745A probably damaging Het
Gusb A T 5: 130,029,246 (GRCm39) H178Q probably benign Het
Hacl1 T C 14: 31,338,437 (GRCm39) Y380C probably damaging Het
Hdac9 T C 12: 34,440,239 (GRCm39) H380R possibly damaging Het
Icam4 T A 9: 20,941,290 (GRCm39) L143Q probably damaging Het
Ikbkb T A 8: 23,185,252 (GRCm39) I43F probably damaging Het
Ints11 G T 4: 155,971,396 (GRCm39) K303N probably damaging Het
Itpa A T 2: 130,509,836 (GRCm39) N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kat6a T A 8: 23,393,228 (GRCm39) N235K probably damaging Het
Kmt2a C T 9: 44,731,900 (GRCm39) V2806I unknown Het
Loxhd1 T A 18: 77,472,637 (GRCm39) F1051L probably damaging Het
Map2 A G 1: 66,453,642 (GRCm39) E844G possibly damaging Het
Mmp7 T A 9: 7,697,749 (GRCm39) Y261* probably null Het
Muc4 A C 16: 32,576,568 (GRCm39) M2023L unknown Het
Mybpc1 C A 10: 88,378,234 (GRCm39) G688V probably damaging Het
Myo3a A G 2: 22,245,954 (GRCm39) T34A probably damaging Het
Nrxn2 A G 19: 6,531,409 (GRCm39) T683A possibly damaging Het
Nup160 A G 2: 90,530,460 (GRCm39) I444V probably damaging Het
Or2t29 A T 11: 58,433,466 (GRCm39) S292T probably damaging Het
Or2t29 A T 11: 58,433,693 (GRCm39) M216K possibly damaging Het
Or4f4-ps1 A C 2: 111,330,198 (GRCm39) K200N possibly damaging Het
Or8w1 T C 2: 87,465,657 (GRCm39) M145V probably benign Het
Pcdha1 A G 18: 37,065,220 (GRCm39) E628G probably damaging Het
Pcdha12 T C 18: 37,155,404 (GRCm39) S708P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pla2g6 T C 15: 79,181,514 (GRCm39) D577G probably damaging Het
Pla2r1 G T 2: 60,279,290 (GRCm39) D763E probably benign Het
Pramel18 A C 4: 101,769,010 (GRCm39) I454L probably benign Het
Psg18 A T 7: 18,079,953 (GRCm39) I416N probably damaging Het
Rapgef6 G T 11: 54,517,414 (GRCm39) V369F probably damaging Het
Rasal3 T C 17: 32,615,767 (GRCm39) E357G probably damaging Het
Rhbdl3 G A 11: 80,221,447 (GRCm39) R195Q probably benign Het
Rnf216 A T 5: 143,084,199 (GRCm39) M1K probably null Het
Rspry1 C A 8: 95,356,469 (GRCm39) D165E probably damaging Het
Rwdd2b G A 16: 87,233,633 (GRCm39) L156F probably benign Het
Scn11a T A 9: 119,644,338 (GRCm39) I141F probably benign Het
Sirt2 A T 7: 28,482,284 (GRCm39) T198S probably benign Het
Slc2a1 A G 4: 118,989,644 (GRCm39) N94D probably damaging Het
Slc33a1 A G 3: 63,855,039 (GRCm39) F407S possibly damaging Het
Slc38a4 A C 15: 96,906,545 (GRCm39) L356R probably damaging Het
Slc43a1 T A 2: 84,687,215 (GRCm39) L372Q probably damaging Het
Slc6a6 T A 6: 91,716,946 (GRCm39) I274N probably damaging Het
Smchd1 C T 17: 71,718,906 (GRCm39) G821D probably damaging Het
Spata33 T C 8: 123,941,146 (GRCm39) F65S unknown Het
Spmip5 A T 19: 58,781,174 (GRCm39) Y25N probably damaging Het
Stx19 A G 16: 62,642,567 (GRCm39) T128A probably benign Het
Tas2r103 T C 6: 133,013,812 (GRCm39) M85V probably benign Het
Tas2r117 C T 6: 132,780,485 (GRCm39) L208F probably damaging Het
Tcirg1 A T 19: 3,952,900 (GRCm39) I233N possibly damaging Het
Uba6 C A 5: 86,300,779 (GRCm39) W192L probably benign Het
Ube3a T C 7: 58,938,525 (GRCm39) I761T probably damaging Het
Unc80 T C 1: 66,549,754 (GRCm39) S671P possibly damaging Het
Usp8 A G 2: 126,593,043 (GRCm39) Q766R probably damaging Het
Vmn2r103 A G 17: 20,032,314 (GRCm39) N696S probably damaging Het
Vmn2r14 G A 5: 109,368,086 (GRCm39) T302I probably benign Het
Vmn2r50 G A 7: 9,771,298 (GRCm39) A801V probably damaging Het
Vmn2r85 T G 10: 130,254,562 (GRCm39) Q707H probably damaging Het
Wsb2 G A 5: 117,501,787 (GRCm39) V51M probably benign Het
Xdh T C 17: 74,246,831 (GRCm39) T78A probably benign Het
Zfp442 T C 2: 150,250,241 (GRCm39) K554E possibly damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117,786,259 (GRCm39) nonsense probably null
IGL01353:Pkd1l2 APN 8 117,784,182 (GRCm39) missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117,748,595 (GRCm39) missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117,786,331 (GRCm39) missense probably benign
IGL01672:Pkd1l2 APN 8 117,807,471 (GRCm39) missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117,783,126 (GRCm39) missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 117,724,913 (GRCm39) missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117,787,264 (GRCm39) missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117,743,655 (GRCm39) missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117,736,303 (GRCm39) splice site probably benign
IGL02381:Pkd1l2 APN 8 117,762,539 (GRCm39) splice site probably benign
IGL02416:Pkd1l2 APN 8 117,767,574 (GRCm39) missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117,767,405 (GRCm39) missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117,756,298 (GRCm39) missense probably benign
IGL02861:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117,740,630 (GRCm39) missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117,750,830 (GRCm39) missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 117,722,548 (GRCm39) missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117,792,484 (GRCm39) missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117,748,761 (GRCm39) missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117,776,787 (GRCm39) splice site probably benign
R0309:Pkd1l2 UTSW 8 117,724,315 (GRCm39) missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117,748,589 (GRCm39) missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117,808,999 (GRCm39) missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117,808,957 (GRCm39) missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117,777,839 (GRCm39) missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117,802,916 (GRCm39) missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117,771,231 (GRCm39) missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117,746,282 (GRCm39) critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117,781,673 (GRCm39) missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117,792,236 (GRCm39) splice site probably benign
R1491:Pkd1l2 UTSW 8 117,755,147 (GRCm39) missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117,772,898 (GRCm39) missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117,792,239 (GRCm39) splice site probably null
R1544:Pkd1l2 UTSW 8 117,764,974 (GRCm39) frame shift probably null
R1558:Pkd1l2 UTSW 8 117,808,991 (GRCm39) missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117,767,514 (GRCm39) missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117,783,158 (GRCm39) missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117,757,458 (GRCm39) missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117,772,921 (GRCm39) nonsense probably null
R1955:Pkd1l2 UTSW 8 117,770,100 (GRCm39) missense probably benign
R1957:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117,769,970 (GRCm39) critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117,746,272 (GRCm39) missense probably benign
R2046:Pkd1l2 UTSW 8 117,726,694 (GRCm39) missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117,808,208 (GRCm39) missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117,757,461 (GRCm39) missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117,783,064 (GRCm39) missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117,770,056 (GRCm39) missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117,746,233 (GRCm39) missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117,792,290 (GRCm39) missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117,795,054 (GRCm39) critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117,767,478 (GRCm39) missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117,746,168 (GRCm39) missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117,738,314 (GRCm39) missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117,781,624 (GRCm39) missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117,799,288 (GRCm39) missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117,774,113 (GRCm39) splice site probably null
R5057:Pkd1l2 UTSW 8 117,781,747 (GRCm39) missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117,783,181 (GRCm39) missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117,761,857 (GRCm39) missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117,757,388 (GRCm39) missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117,792,569 (GRCm39) missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117,794,855 (GRCm39) missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117,767,522 (GRCm39) nonsense probably null
R5610:Pkd1l2 UTSW 8 117,769,059 (GRCm39) missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117,781,757 (GRCm39) missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117,792,485 (GRCm39) missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117,781,750 (GRCm39) missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 117,724,321 (GRCm39) missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117,756,387 (GRCm39) missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117,750,795 (GRCm39) missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117,740,726 (GRCm39) missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117,809,107 (GRCm39) missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117,808,209 (GRCm39) missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117,762,586 (GRCm39) missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117,767,405 (GRCm39) missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117,757,370 (GRCm39) missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117,740,681 (GRCm39) missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117,802,870 (GRCm39) nonsense probably null
R7148:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117,767,574 (GRCm39) missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 117,722,536 (GRCm39) missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117,750,773 (GRCm39) missense probably benign
R7382:Pkd1l2 UTSW 8 117,781,610 (GRCm39) missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117,762,641 (GRCm39) missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117,755,218 (GRCm39) missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117,794,849 (GRCm39) missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117,787,333 (GRCm39) missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117,792,268 (GRCm39) missense probably benign
R7590:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117,756,384 (GRCm39) missense probably damaging 1.00
R7897:Pkd1l2 UTSW 8 117,724,827 (GRCm39) missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117,777,926 (GRCm39) missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117,802,921 (GRCm39) missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117,774,236 (GRCm39) missense probably benign
R8145:Pkd1l2 UTSW 8 117,781,742 (GRCm39) missense probably benign
R8228:Pkd1l2 UTSW 8 117,792,514 (GRCm39) missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117,767,472 (GRCm39) missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117,774,302 (GRCm39) critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117,792,311 (GRCm39) missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 117,726,660 (GRCm39) missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117,740,615 (GRCm39) missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 117,726,717 (GRCm39) missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117,764,849 (GRCm39) missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117,769,037 (GRCm39) missense probably benign 0.32
R9091:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9138:Pkd1l2 UTSW 8 117,781,748 (GRCm39) missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117,746,159 (GRCm39) missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9735:Pkd1l2 UTSW 8 117,772,820 (GRCm39) missense possibly damaging 0.94
Z1176:Pkd1l2 UTSW 8 117,781,653 (GRCm39) missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117,757,430 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCTGGTCTGATGACTG -3'
(R):5'- AGTTTTGGACACACAGCCC -3'

Sequencing Primer
(F):5'- TCTGATGACTGGGCCAGTGC -3'
(R):5'- AAACCTAATGAATCTTCCCTTCCTAG -3'
Posted On 2019-11-26