Incidental Mutation 'R7768:Pkd1l2'
ID 598390
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 116995679-117082449 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 117054860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000098375
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109093
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Acy1 G A 9: 106,433,618 T317M possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dmxl2 T C 9: 54,380,939 Y2628C probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Psg18 A T 7: 18,346,028 I416N probably damaging Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc33a1 A G 3: 63,947,618 F407S possibly damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Smchd1 C T 17: 71,411,911 G821D probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Usp8 A G 2: 126,751,123 Q766R probably damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117068110 missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117060594 missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117065529 missense probably benign
R7590:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117029645 missense probably damaging 1.00
R7897:Pkd1l2 UTSW 8 116998088 missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117051187 missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117076182 missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117047497 missense probably benign
R8145:Pkd1l2 UTSW 8 117055003 missense probably benign
R8228:Pkd1l2 UTSW 8 117065775 missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117040733 missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117047563 critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117065572 missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 116999921 missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117013876 missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 116999978 missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117038110 missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117042298 missense probably benign 0.32
R9091:Pkd1l2 UTSW 8 117032694 missense probably damaging 1.00
R9138:Pkd1l2 UTSW 8 117055009 missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117019420 missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117032694 missense probably damaging 1.00
Z1176:Pkd1l2 UTSW 8 117054914 missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117030691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCTGGTCTGATGACTG -3'
(R):5'- AGTTTTGGACACACAGCCC -3'

Sequencing Primer
(F):5'- TCTGATGACTGGGCCAGTGC -3'
(R):5'- AAACCTAATGAATCTTCCCTTCCTAG -3'
Posted On 2019-11-26