Incidental Mutation 'R7768:Dmxl2'
ID598395
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene NameDmx-like 2
SynonymsE130119P06Rik, 6430411K14Rik
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7768 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location54365158-54501626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54380939 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2628 (Y2628C)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]
Predicted Effect probably damaging
Transcript: ENSMUST00000118163
AA Change: Y2628C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: Y2628C

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000118600
AA Change: Y2627C
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: Y2627C

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: Y1829C

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Acy1 G A 9: 106,433,618 T317M possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y not run Het
Pkd1l2 A G 8: 117,054,860 probably null Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Psg18 A T 7: 18,346,028 I416N probably damaging Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc33a1 A G 3: 63,947,618 F407S possibly damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Smchd1 C T 17: 71,411,911 G821D probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Usp8 A G 2: 126,751,123 Q766R probably damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54401523 missense probably benign
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54446512 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54450924 missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54446405 unclassified probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 unclassified probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54450879 missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54401585 missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54366632 splice site probably null
R7526:Dmxl2 UTSW 9 54400957 missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54415987 missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54472218 missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54457794 missense unknown
R7703:Dmxl2 UTSW 9 54461086 missense probably benign 0.01
R8007:Dmxl2 UTSW 9 54383691 nonsense probably null
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Z1177:Dmxl2 UTSW 9 54382034 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCAACTGTCACTTGAACATGTG -3'
(R):5'- ACAGCTGTGTTGTTTGAATGAC -3'

Sequencing Primer
(F):5'- CTGTCACTTGAACATGTGAGTTACC -3'
(R):5'- CTTTGAAGCAGTTAAAGCAAGTGTC -3'
Posted On2019-11-26