Incidental Mutation 'R7768:Acy1'
ID598396
Institutional Source Beutler Lab
Gene Symbol Acy1
Ensembl Gene ENSMUSG00000023262
Gene Nameaminoacylase 1
Synonyms1110014J22Rik, Acy-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7768 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location106432981-106438319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106433618 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 317 (T317M)
Ref Sequence ENSEMBL: ENSMUSP00000024031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024031] [ENSMUST00000059802] [ENSMUST00000098994] [ENSMUST00000150576] [ENSMUST00000190803] [ENSMUST00000190900] [ENSMUST00000190972] [ENSMUST00000213448] [ENSMUST00000214067] [ENSMUST00000214275] [ENSMUST00000215395] [ENSMUST00000215506] [ENSMUST00000216400] [ENSMUST00000217081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024031
AA Change: T317M

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024031
Gene: ENSMUSG00000023262
AA Change: T317M

DomainStartEndE-ValueType
Pfam:Peptidase_M28 61 239 8.6e-8 PFAM
Pfam:Peptidase_M20 76 397 1.8e-38 PFAM
Pfam:M20_dimer 188 302 1.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059802
SMART Domains Protein: ENSMUSP00000080203
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 1.4e-30 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098994
SMART Domains Protein: ENSMUSP00000096592
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 2.6e-27 PFAM
low complexity region 126 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150576
SMART Domains Protein: ENSMUSP00000117834
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 9.8e-28 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190803
Predicted Effect probably benign
Transcript: ENSMUST00000190900
SMART Domains Protein: ENSMUSP00000140582
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
PDB:1Q7L|C 1 50 9e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190972
SMART Domains Protein: ENSMUSP00000139953
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M20 76 216 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213448
Predicted Effect probably benign
Transcript: ENSMUST00000214067
Predicted Effect possibly damaging
Transcript: ENSMUST00000214275
AA Change: T282M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000215395
AA Change: T252M

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215506
Predicted Effect probably benign
Transcript: ENSMUST00000216400
AA Change: T245M

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217081
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dmxl2 T C 9: 54,380,939 Y2628C probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd1l2 A G 8: 117,054,860 probably null Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Psg18 A T 7: 18,346,028 I416N probably damaging Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc33a1 A G 3: 63,947,618 F407S possibly damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Smchd1 C T 17: 71,411,911 G821D probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Usp8 A G 2: 126,751,123 Q766R probably damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Acy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Acy1 APN 9 106436807 unclassified probably benign
IGL03029:Acy1 APN 9 106435115 missense probably damaging 0.98
IGL03304:Acy1 APN 9 106435466 critical splice donor site probably null
R0691:Acy1 UTSW 9 106435871 splice site probably null
R2152:Acy1 UTSW 9 106435617 missense probably damaging 1.00
R3882:Acy1 UTSW 9 106435509 missense possibly damaging 0.75
R4019:Acy1 UTSW 9 106436779 missense possibly damaging 0.94
R4421:Acy1 UTSW 9 106435713 splice site probably null
R4700:Acy1 UTSW 9 106433583 missense probably benign 0.00
R4931:Acy1 UTSW 9 106433191 missense probably damaging 1.00
R4934:Acy1 UTSW 9 106435122 missense probably null 1.00
R5030:Acy1 UTSW 9 106433397 missense probably benign 0.31
R5482:Acy1 UTSW 9 106434639 intron probably benign
R5748:Acy1 UTSW 9 106436727 missense probably damaging 1.00
R6932:Acy1 UTSW 9 106437627 critical splice donor site probably null
R7468:Acy1 UTSW 9 106437722 start codon destroyed probably null 0.64
R8144:Acy1 UTSW 9 106436120 splice site probably null
R8226:Acy1 UTSW 9 106437658 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAAAGATCTCTGGCTCCAG -3'
(R):5'- ACCTAGGGCATTGGAAGGAC -3'

Sequencing Primer
(F):5'- CTCCAGAGTGAGGTTCCTGAAG -3'
(R):5'- CTGGAAGAGGACCTGGGGC -3'
Posted On2019-11-26