Mutagenetix > Incidental Mutation

Incidental Mutation 'R7768:Rapgef6'

598403

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7768 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 54626588 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 369 (V369F)

Ref Sequence

ENSEMBL: ENSMUSP00000104523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]

AlphaFold

Q5NCJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000094536
AA Change: V84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: V84F

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101206
AA Change: V369F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: V369F

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102743
AA Change: V369F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: V369F

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108894
AA Change: V84F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: V84F

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108895
AA Change: V369F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: V369F

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.95e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	526	1.03e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: V369F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218995
AA Change: V222F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	A	T	19: 58,792,742	Y25N	probably damaging	Het
Actn2	A	G	13: 12,282,594	V479A	possibly damaging	Het
Acy1	G	A	9: 106,433,618	T317M	possibly damaging	Het
Adgrg6	A	T	10: 14,431,666	D797E	probably benign	Het
Ank1	C	T	8: 23,097,997	A552V	probably benign	Het
Ankrd13c	A	G	3: 157,988,647	T262A	probably benign	Het
Ap4e1	A	T	2: 127,046,934	N468Y	probably damaging	Het
Apbb1	T	C	7: 105,567,088	I367V	probably benign	Het
Arl6	A	G	16: 59,632,336	I33T	probably damaging	Het
Asgr2	T	C	11: 70,105,416	I228T	probably damaging	Het
Aspn	A	G	13: 49,557,395	H172R	probably damaging	Het
Bclaf1	T	A	10: 20,339,771	F868L	probably benign	Het
Cacna1i	G	A	15: 80,381,188	R1547H	probably damaging	Het
Celsr1	G	T	15: 85,932,409	Q1778K	probably benign	Het
Cep250	T	C	2: 155,986,009	L42S		Het
Clnk	C	A	5: 38,768,158	R100L	probably damaging	Het
Cpvl	A	G	6: 53,896,491	V420A	possibly damaging	Het
Dicer1	C	A	12: 104,706,697	G825V	probably damaging	Het
Dmxl2	T	C	9: 54,380,939	Y2628C	probably damaging	Het
Dnah7b	T	A	1: 46,137,474	H751Q	probably benign	Het
Dnhd1	C	A	7: 105,721,095	R4576S	possibly damaging	Het
Dzip1	A	T	14: 118,879,498	D775E	probably benign	Het
Erich3	T	A	3: 154,748,331	M381K	probably benign	Het
Fam193a	A	G	5: 34,465,791	D1241G	possibly damaging	Het
Gbx2	A	G	1: 89,928,984	L228P	probably benign	Het
Ggt7	A	T	2: 155,506,501	M77K	possibly damaging	Het
Gm12800	A	C	4: 101,911,813	I454L	probably benign	Het
Gpr26	T	A	7: 131,974,348	I247K	probably damaging	Het
Grip1	A	G	10: 120,038,397	T745A	probably damaging	Het
Gusb	A	T	5: 130,000,405	H178Q	probably benign	Het
Hacl1	T	C	14: 31,616,480	Y380C	probably damaging	Het
Hdac9	T	C	12: 34,390,240	H380R	possibly damaging	Het
Icam4	T	A	9: 21,029,994	L143Q	probably damaging	Het
Ikbkb	T	A	8: 22,695,236	I43F	probably damaging	Het
Ints11	G	T	4: 155,886,939	K303N	probably damaging	Het
Itpa	A	T	2: 130,667,916	N16I	probably damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kat6a	T	A	8: 22,903,212	N235K	probably damaging	Het
Kmt2a	C	T	9: 44,820,603	V2806I	unknown	Het
Loxhd1	T	A	18: 77,384,941	F1051L	probably damaging	Het
Map2	A	G	1: 66,414,483	E844G	possibly damaging	Het
Mmp7	T	A	9: 7,697,748	Y261*	probably null	Het
Muc4	A	C	16: 32,756,194	M2023L	unknown	Het
Mybpc1	C	A	10: 88,542,372	G688V	probably damaging	Het
Myo3a	A	G	2: 22,241,143	T34A	probably damaging	Het
Nrxn2	A	G	19: 6,481,379	T683A	possibly damaging	Het
Nup160	A	G	2: 90,700,116	I444V	probably damaging	Het
Olfr1132	T	C	2: 87,635,313	M145V	probably benign	Het
Olfr1291-ps1	A	C	2: 111,499,853	K200N	possibly damaging	Het
Olfr329-ps	A	T	11: 58,542,640	S292T	probably damaging	Het
Olfr329-ps	A	T	11: 58,542,867	M216K	possibly damaging	Het
Pcdha1	A	G	18: 36,932,167	E628G	probably damaging	Het
Pcdha12	T	C	18: 37,022,351	S708P	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Pkd1l2	A	G	8: 117,054,860		probably null	Het
Pla2g6	T	C	15: 79,297,314	D577G	probably damaging	Het
Pla2r1	G	T	2: 60,448,946	D763E	probably benign	Het
Psg18	A	T	7: 18,346,028	I416N	probably damaging	Het
Rasal3	T	C	17: 32,396,793	E357G	probably damaging	Het
Rhbdl3	G	A	11: 80,330,621	R195Q	probably benign	Het
Rnf216	A	T	5: 143,098,444	M1K	probably null	Het
Rspry1	C	A	8: 94,629,841	D165E	probably damaging	Het
Rwdd2b	G	A	16: 87,436,745	L156F	probably benign	Het
Scn11a	T	A	9: 119,815,272	I141F	probably benign	Het
Sirt2	A	T	7: 28,782,859	T198S	probably benign	Het
Slc2a1	A	G	4: 119,132,447	N94D	probably damaging	Het
Slc33a1	A	G	3: 63,947,618	F407S	possibly damaging	Het
Slc38a4	A	C	15: 97,008,664	L356R	probably damaging	Het
Slc43a1	T	A	2: 84,856,871	L372Q	probably damaging	Het
Slc6a6	T	A	6: 91,739,965	I274N	probably damaging	Het
Smchd1	C	T	17: 71,411,911	G821D	probably damaging	Het
Spata33	T	C	8: 123,214,407	F65S	unknown	Het
Stx19	A	G	16: 62,822,204	T128A	probably benign	Het
Tas2r103	T	C	6: 133,036,849	M85V	probably benign	Het
Tas2r117	C	T	6: 132,803,522	L208F	probably damaging	Het
Tcirg1	A	T	19: 3,902,900	I233N	possibly damaging	Het
Uba6	C	A	5: 86,152,920	W192L	probably benign	Het
Ube3a	T	C	7: 59,288,777	I761T	probably damaging	Het
Unc80	T	C	1: 66,510,595	S671P	possibly damaging	Het
Usp8	A	G	2: 126,751,123	Q766R	probably damaging	Het
Vmn2r103	A	G	17: 19,812,052	N696S	probably damaging	Het
Vmn2r14	G	A	5: 109,220,220	T302I	probably benign	Het
Vmn2r50	G	A	7: 10,037,371	A801V	probably damaging	Het
Vmn2r85	T	G	10: 130,418,693	Q707H	probably damaging	Het
Wsb2	G	A	5: 117,363,722	V51M	probably benign	Het
Xdh	T	C	17: 73,939,836	T78A	probably benign	Het
Zfp442	T	C	2: 150,408,321	K554E	possibly damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGATTCCACTTTGGTCTCTGTG -3'
(R):5'- ACCCCTTATCATTCAGATGTGTAAG -3'

Sequencing Primer
(F):5'- CCACTTTGGTCTCTGTGTGAATTG -3'
(R):5'- AGATGAAAGATCTGAATGCAGTTTC -3'

Posted On

2019-11-26