Incidental Mutation 'R7768:Cacna1i'
ID 598415
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 045824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80265389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1547 (R1547H)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: R1547H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: R1547H

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: R1547H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: R1547H

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 A G 13: 12,297,480 (GRCm39) V479A possibly damaging Het
Acy1 G A 9: 106,310,817 (GRCm39) T317M possibly damaging Het
Adgrg6 A T 10: 14,307,410 (GRCm39) D797E probably benign Het
Ank1 C T 8: 23,588,013 (GRCm39) A552V probably benign Het
Ankrd13c A G 3: 157,694,284 (GRCm39) T262A probably benign Het
Ap4e1 A T 2: 126,888,854 (GRCm39) N468Y probably damaging Het
Apbb1 T C 7: 105,216,295 (GRCm39) I367V probably benign Het
Arl6 A G 16: 59,452,699 (GRCm39) I33T probably damaging Het
Asgr2 T C 11: 69,996,242 (GRCm39) I228T probably damaging Het
Aspn A G 13: 49,710,871 (GRCm39) H172R probably damaging Het
Bclaf1 T A 10: 20,215,517 (GRCm39) F868L probably benign Het
Celsr1 G T 15: 85,816,610 (GRCm39) Q1778K probably benign Het
Cep250 T C 2: 155,827,929 (GRCm39) L42S Het
Clnk C A 5: 38,925,501 (GRCm39) R100L probably damaging Het
Cpvl A G 6: 53,873,476 (GRCm39) V420A possibly damaging Het
Dicer1 C A 12: 104,672,956 (GRCm39) G825V probably damaging Het
Dmxl2 T C 9: 54,288,223 (GRCm39) Y2628C probably damaging Het
Dnah7b T A 1: 46,176,634 (GRCm39) H751Q probably benign Het
Dnhd1 C A 7: 105,370,302 (GRCm39) R4576S possibly damaging Het
Dzip1 A T 14: 119,116,910 (GRCm39) D775E probably benign Het
Erich3 T A 3: 154,453,968 (GRCm39) M381K probably benign Het
Fam193a A G 5: 34,623,135 (GRCm39) D1241G possibly damaging Het
Gbx2 A G 1: 89,856,706 (GRCm39) L228P probably benign Het
Ggt7 A T 2: 155,348,421 (GRCm39) M77K possibly damaging Het
Gpr26 T A 7: 131,576,077 (GRCm39) I247K probably damaging Het
Grip1 A G 10: 119,874,302 (GRCm39) T745A probably damaging Het
Gusb A T 5: 130,029,246 (GRCm39) H178Q probably benign Het
Hacl1 T C 14: 31,338,437 (GRCm39) Y380C probably damaging Het
Hdac9 T C 12: 34,440,239 (GRCm39) H380R possibly damaging Het
Icam4 T A 9: 20,941,290 (GRCm39) L143Q probably damaging Het
Ikbkb T A 8: 23,185,252 (GRCm39) I43F probably damaging Het
Ints11 G T 4: 155,971,396 (GRCm39) K303N probably damaging Het
Itpa A T 2: 130,509,836 (GRCm39) N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kat6a T A 8: 23,393,228 (GRCm39) N235K probably damaging Het
Kmt2a C T 9: 44,731,900 (GRCm39) V2806I unknown Het
Loxhd1 T A 18: 77,472,637 (GRCm39) F1051L probably damaging Het
Map2 A G 1: 66,453,642 (GRCm39) E844G possibly damaging Het
Mmp7 T A 9: 7,697,749 (GRCm39) Y261* probably null Het
Muc4 A C 16: 32,576,568 (GRCm39) M2023L unknown Het
Mybpc1 C A 10: 88,378,234 (GRCm39) G688V probably damaging Het
Myo3a A G 2: 22,245,954 (GRCm39) T34A probably damaging Het
Nrxn2 A G 19: 6,531,409 (GRCm39) T683A possibly damaging Het
Nup160 A G 2: 90,530,460 (GRCm39) I444V probably damaging Het
Or2t29 A T 11: 58,433,466 (GRCm39) S292T probably damaging Het
Or2t29 A T 11: 58,433,693 (GRCm39) M216K possibly damaging Het
Or4f4-ps1 A C 2: 111,330,198 (GRCm39) K200N possibly damaging Het
Or8w1 T C 2: 87,465,657 (GRCm39) M145V probably benign Het
Pcdha1 A G 18: 37,065,220 (GRCm39) E628G probably damaging Het
Pcdha12 T C 18: 37,155,404 (GRCm39) S708P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd1l2 A G 8: 117,781,599 (GRCm39) probably null Het
Pla2g6 T C 15: 79,181,514 (GRCm39) D577G probably damaging Het
Pla2r1 G T 2: 60,279,290 (GRCm39) D763E probably benign Het
Pramel18 A C 4: 101,769,010 (GRCm39) I454L probably benign Het
Psg18 A T 7: 18,079,953 (GRCm39) I416N probably damaging Het
Rapgef6 G T 11: 54,517,414 (GRCm39) V369F probably damaging Het
Rasal3 T C 17: 32,615,767 (GRCm39) E357G probably damaging Het
Rhbdl3 G A 11: 80,221,447 (GRCm39) R195Q probably benign Het
Rnf216 A T 5: 143,084,199 (GRCm39) M1K probably null Het
Rspry1 C A 8: 95,356,469 (GRCm39) D165E probably damaging Het
Rwdd2b G A 16: 87,233,633 (GRCm39) L156F probably benign Het
Scn11a T A 9: 119,644,338 (GRCm39) I141F probably benign Het
Sirt2 A T 7: 28,482,284 (GRCm39) T198S probably benign Het
Slc2a1 A G 4: 118,989,644 (GRCm39) N94D probably damaging Het
Slc33a1 A G 3: 63,855,039 (GRCm39) F407S possibly damaging Het
Slc38a4 A C 15: 96,906,545 (GRCm39) L356R probably damaging Het
Slc43a1 T A 2: 84,687,215 (GRCm39) L372Q probably damaging Het
Slc6a6 T A 6: 91,716,946 (GRCm39) I274N probably damaging Het
Smchd1 C T 17: 71,718,906 (GRCm39) G821D probably damaging Het
Spata33 T C 8: 123,941,146 (GRCm39) F65S unknown Het
Spmip5 A T 19: 58,781,174 (GRCm39) Y25N probably damaging Het
Stx19 A G 16: 62,642,567 (GRCm39) T128A probably benign Het
Tas2r103 T C 6: 133,013,812 (GRCm39) M85V probably benign Het
Tas2r117 C T 6: 132,780,485 (GRCm39) L208F probably damaging Het
Tcirg1 A T 19: 3,952,900 (GRCm39) I233N possibly damaging Het
Uba6 C A 5: 86,300,779 (GRCm39) W192L probably benign Het
Ube3a T C 7: 58,938,525 (GRCm39) I761T probably damaging Het
Unc80 T C 1: 66,549,754 (GRCm39) S671P possibly damaging Het
Usp8 A G 2: 126,593,043 (GRCm39) Q766R probably damaging Het
Vmn2r103 A G 17: 20,032,314 (GRCm39) N696S probably damaging Het
Vmn2r14 G A 5: 109,368,086 (GRCm39) T302I probably benign Het
Vmn2r50 G A 7: 9,771,298 (GRCm39) A801V probably damaging Het
Vmn2r85 T G 10: 130,254,562 (GRCm39) Q707H probably damaging Het
Wsb2 G A 5: 117,501,787 (GRCm39) V51M probably benign Het
Xdh T C 17: 74,246,831 (GRCm39) T78A probably benign Het
Zfp442 T C 2: 150,250,241 (GRCm39) K554E possibly damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTCTGAGCCACTATGCTTC -3'
(R):5'- ATGCTGTCATGAGGAAGCAG -3'

Sequencing Primer
(F):5'- GAGCCACTATGCTTCTCCCTCAC -3'
(R):5'- GGGGCAACACTTCTTTTGAATC -3'
Posted On 2019-11-26