Incidental Mutation 'R7768:Vmn2r103'
ID 598422
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 045824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20032314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 696 (N696S)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: N696S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: N696S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 A G 13: 12,297,480 (GRCm39) V479A possibly damaging Het
Acy1 G A 9: 106,310,817 (GRCm39) T317M possibly damaging Het
Adgrg6 A T 10: 14,307,410 (GRCm39) D797E probably benign Het
Ank1 C T 8: 23,588,013 (GRCm39) A552V probably benign Het
Ankrd13c A G 3: 157,694,284 (GRCm39) T262A probably benign Het
Ap4e1 A T 2: 126,888,854 (GRCm39) N468Y probably damaging Het
Apbb1 T C 7: 105,216,295 (GRCm39) I367V probably benign Het
Arl6 A G 16: 59,452,699 (GRCm39) I33T probably damaging Het
Asgr2 T C 11: 69,996,242 (GRCm39) I228T probably damaging Het
Aspn A G 13: 49,710,871 (GRCm39) H172R probably damaging Het
Bclaf1 T A 10: 20,215,517 (GRCm39) F868L probably benign Het
Cacna1i G A 15: 80,265,389 (GRCm39) R1547H probably damaging Het
Celsr1 G T 15: 85,816,610 (GRCm39) Q1778K probably benign Het
Cep250 T C 2: 155,827,929 (GRCm39) L42S Het
Clnk C A 5: 38,925,501 (GRCm39) R100L probably damaging Het
Cpvl A G 6: 53,873,476 (GRCm39) V420A possibly damaging Het
Dicer1 C A 12: 104,672,956 (GRCm39) G825V probably damaging Het
Dmxl2 T C 9: 54,288,223 (GRCm39) Y2628C probably damaging Het
Dnah7b T A 1: 46,176,634 (GRCm39) H751Q probably benign Het
Dnhd1 C A 7: 105,370,302 (GRCm39) R4576S possibly damaging Het
Dzip1 A T 14: 119,116,910 (GRCm39) D775E probably benign Het
Erich3 T A 3: 154,453,968 (GRCm39) M381K probably benign Het
Fam193a A G 5: 34,623,135 (GRCm39) D1241G possibly damaging Het
Gbx2 A G 1: 89,856,706 (GRCm39) L228P probably benign Het
Ggt7 A T 2: 155,348,421 (GRCm39) M77K possibly damaging Het
Gpr26 T A 7: 131,576,077 (GRCm39) I247K probably damaging Het
Grip1 A G 10: 119,874,302 (GRCm39) T745A probably damaging Het
Gusb A T 5: 130,029,246 (GRCm39) H178Q probably benign Het
Hacl1 T C 14: 31,338,437 (GRCm39) Y380C probably damaging Het
Hdac9 T C 12: 34,440,239 (GRCm39) H380R possibly damaging Het
Icam4 T A 9: 20,941,290 (GRCm39) L143Q probably damaging Het
Ikbkb T A 8: 23,185,252 (GRCm39) I43F probably damaging Het
Ints11 G T 4: 155,971,396 (GRCm39) K303N probably damaging Het
Itpa A T 2: 130,509,836 (GRCm39) N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kat6a T A 8: 23,393,228 (GRCm39) N235K probably damaging Het
Kmt2a C T 9: 44,731,900 (GRCm39) V2806I unknown Het
Loxhd1 T A 18: 77,472,637 (GRCm39) F1051L probably damaging Het
Map2 A G 1: 66,453,642 (GRCm39) E844G possibly damaging Het
Mmp7 T A 9: 7,697,749 (GRCm39) Y261* probably null Het
Muc4 A C 16: 32,576,568 (GRCm39) M2023L unknown Het
Mybpc1 C A 10: 88,378,234 (GRCm39) G688V probably damaging Het
Myo3a A G 2: 22,245,954 (GRCm39) T34A probably damaging Het
Nrxn2 A G 19: 6,531,409 (GRCm39) T683A possibly damaging Het
Nup160 A G 2: 90,530,460 (GRCm39) I444V probably damaging Het
Or2t29 A T 11: 58,433,466 (GRCm39) S292T probably damaging Het
Or2t29 A T 11: 58,433,693 (GRCm39) M216K possibly damaging Het
Or4f4-ps1 A C 2: 111,330,198 (GRCm39) K200N possibly damaging Het
Or8w1 T C 2: 87,465,657 (GRCm39) M145V probably benign Het
Pcdha1 A G 18: 37,065,220 (GRCm39) E628G probably damaging Het
Pcdha12 T C 18: 37,155,404 (GRCm39) S708P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd1l2 A G 8: 117,781,599 (GRCm39) probably null Het
Pla2g6 T C 15: 79,181,514 (GRCm39) D577G probably damaging Het
Pla2r1 G T 2: 60,279,290 (GRCm39) D763E probably benign Het
Pramel18 A C 4: 101,769,010 (GRCm39) I454L probably benign Het
Psg18 A T 7: 18,079,953 (GRCm39) I416N probably damaging Het
Rapgef6 G T 11: 54,517,414 (GRCm39) V369F probably damaging Het
Rasal3 T C 17: 32,615,767 (GRCm39) E357G probably damaging Het
Rhbdl3 G A 11: 80,221,447 (GRCm39) R195Q probably benign Het
Rnf216 A T 5: 143,084,199 (GRCm39) M1K probably null Het
Rspry1 C A 8: 95,356,469 (GRCm39) D165E probably damaging Het
Rwdd2b G A 16: 87,233,633 (GRCm39) L156F probably benign Het
Scn11a T A 9: 119,644,338 (GRCm39) I141F probably benign Het
Sirt2 A T 7: 28,482,284 (GRCm39) T198S probably benign Het
Slc2a1 A G 4: 118,989,644 (GRCm39) N94D probably damaging Het
Slc33a1 A G 3: 63,855,039 (GRCm39) F407S possibly damaging Het
Slc38a4 A C 15: 96,906,545 (GRCm39) L356R probably damaging Het
Slc43a1 T A 2: 84,687,215 (GRCm39) L372Q probably damaging Het
Slc6a6 T A 6: 91,716,946 (GRCm39) I274N probably damaging Het
Smchd1 C T 17: 71,718,906 (GRCm39) G821D probably damaging Het
Spata33 T C 8: 123,941,146 (GRCm39) F65S unknown Het
Spmip5 A T 19: 58,781,174 (GRCm39) Y25N probably damaging Het
Stx19 A G 16: 62,642,567 (GRCm39) T128A probably benign Het
Tas2r103 T C 6: 133,013,812 (GRCm39) M85V probably benign Het
Tas2r117 C T 6: 132,780,485 (GRCm39) L208F probably damaging Het
Tcirg1 A T 19: 3,952,900 (GRCm39) I233N possibly damaging Het
Uba6 C A 5: 86,300,779 (GRCm39) W192L probably benign Het
Ube3a T C 7: 58,938,525 (GRCm39) I761T probably damaging Het
Unc80 T C 1: 66,549,754 (GRCm39) S671P possibly damaging Het
Usp8 A G 2: 126,593,043 (GRCm39) Q766R probably damaging Het
Vmn2r14 G A 5: 109,368,086 (GRCm39) T302I probably benign Het
Vmn2r50 G A 7: 9,771,298 (GRCm39) A801V probably damaging Het
Vmn2r85 T G 10: 130,254,562 (GRCm39) Q707H probably damaging Het
Wsb2 G A 5: 117,501,787 (GRCm39) V51M probably benign Het
Xdh T C 17: 74,246,831 (GRCm39) T78A probably benign Het
Zfp442 T C 2: 150,250,241 (GRCm39) K554E possibly damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGAGCTCTCAGTTACATTTTGC -3'
(R):5'- ACTTCCAAGGGCCAAGAAGC -3'

Sequencing Primer
(F):5'- GTTCTTTGAACTTCATTGGTCAGC -3'
(R):5'- GGCCAAGAAGCAGAGATATCCC -3'
Posted On 2019-11-26