Incidental Mutation 'R7768:Smchd1'
ID 598424
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 045824-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R7768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71718906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 821 (G821D)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: G821D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: G821D

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 A G 13: 12,297,480 (GRCm39) V479A possibly damaging Het
Acy1 G A 9: 106,310,817 (GRCm39) T317M possibly damaging Het
Adgrg6 A T 10: 14,307,410 (GRCm39) D797E probably benign Het
Ank1 C T 8: 23,588,013 (GRCm39) A552V probably benign Het
Ankrd13c A G 3: 157,694,284 (GRCm39) T262A probably benign Het
Ap4e1 A T 2: 126,888,854 (GRCm39) N468Y probably damaging Het
Apbb1 T C 7: 105,216,295 (GRCm39) I367V probably benign Het
Arl6 A G 16: 59,452,699 (GRCm39) I33T probably damaging Het
Asgr2 T C 11: 69,996,242 (GRCm39) I228T probably damaging Het
Aspn A G 13: 49,710,871 (GRCm39) H172R probably damaging Het
Bclaf1 T A 10: 20,215,517 (GRCm39) F868L probably benign Het
Cacna1i G A 15: 80,265,389 (GRCm39) R1547H probably damaging Het
Celsr1 G T 15: 85,816,610 (GRCm39) Q1778K probably benign Het
Cep250 T C 2: 155,827,929 (GRCm39) L42S Het
Clnk C A 5: 38,925,501 (GRCm39) R100L probably damaging Het
Cpvl A G 6: 53,873,476 (GRCm39) V420A possibly damaging Het
Dicer1 C A 12: 104,672,956 (GRCm39) G825V probably damaging Het
Dmxl2 T C 9: 54,288,223 (GRCm39) Y2628C probably damaging Het
Dnah7b T A 1: 46,176,634 (GRCm39) H751Q probably benign Het
Dnhd1 C A 7: 105,370,302 (GRCm39) R4576S possibly damaging Het
Dzip1 A T 14: 119,116,910 (GRCm39) D775E probably benign Het
Erich3 T A 3: 154,453,968 (GRCm39) M381K probably benign Het
Fam193a A G 5: 34,623,135 (GRCm39) D1241G possibly damaging Het
Gbx2 A G 1: 89,856,706 (GRCm39) L228P probably benign Het
Ggt7 A T 2: 155,348,421 (GRCm39) M77K possibly damaging Het
Gpr26 T A 7: 131,576,077 (GRCm39) I247K probably damaging Het
Grip1 A G 10: 119,874,302 (GRCm39) T745A probably damaging Het
Gusb A T 5: 130,029,246 (GRCm39) H178Q probably benign Het
Hacl1 T C 14: 31,338,437 (GRCm39) Y380C probably damaging Het
Hdac9 T C 12: 34,440,239 (GRCm39) H380R possibly damaging Het
Icam4 T A 9: 20,941,290 (GRCm39) L143Q probably damaging Het
Ikbkb T A 8: 23,185,252 (GRCm39) I43F probably damaging Het
Ints11 G T 4: 155,971,396 (GRCm39) K303N probably damaging Het
Itpa A T 2: 130,509,836 (GRCm39) N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kat6a T A 8: 23,393,228 (GRCm39) N235K probably damaging Het
Kmt2a C T 9: 44,731,900 (GRCm39) V2806I unknown Het
Loxhd1 T A 18: 77,472,637 (GRCm39) F1051L probably damaging Het
Map2 A G 1: 66,453,642 (GRCm39) E844G possibly damaging Het
Mmp7 T A 9: 7,697,749 (GRCm39) Y261* probably null Het
Muc4 A C 16: 32,576,568 (GRCm39) M2023L unknown Het
Mybpc1 C A 10: 88,378,234 (GRCm39) G688V probably damaging Het
Myo3a A G 2: 22,245,954 (GRCm39) T34A probably damaging Het
Nrxn2 A G 19: 6,531,409 (GRCm39) T683A possibly damaging Het
Nup160 A G 2: 90,530,460 (GRCm39) I444V probably damaging Het
Or2t29 A T 11: 58,433,466 (GRCm39) S292T probably damaging Het
Or2t29 A T 11: 58,433,693 (GRCm39) M216K possibly damaging Het
Or4f4-ps1 A C 2: 111,330,198 (GRCm39) K200N possibly damaging Het
Or8w1 T C 2: 87,465,657 (GRCm39) M145V probably benign Het
Pcdha1 A G 18: 37,065,220 (GRCm39) E628G probably damaging Het
Pcdha12 T C 18: 37,155,404 (GRCm39) S708P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd1l2 A G 8: 117,781,599 (GRCm39) probably null Het
Pla2g6 T C 15: 79,181,514 (GRCm39) D577G probably damaging Het
Pla2r1 G T 2: 60,279,290 (GRCm39) D763E probably benign Het
Pramel18 A C 4: 101,769,010 (GRCm39) I454L probably benign Het
Psg18 A T 7: 18,079,953 (GRCm39) I416N probably damaging Het
Rapgef6 G T 11: 54,517,414 (GRCm39) V369F probably damaging Het
Rasal3 T C 17: 32,615,767 (GRCm39) E357G probably damaging Het
Rhbdl3 G A 11: 80,221,447 (GRCm39) R195Q probably benign Het
Rnf216 A T 5: 143,084,199 (GRCm39) M1K probably null Het
Rspry1 C A 8: 95,356,469 (GRCm39) D165E probably damaging Het
Rwdd2b G A 16: 87,233,633 (GRCm39) L156F probably benign Het
Scn11a T A 9: 119,644,338 (GRCm39) I141F probably benign Het
Sirt2 A T 7: 28,482,284 (GRCm39) T198S probably benign Het
Slc2a1 A G 4: 118,989,644 (GRCm39) N94D probably damaging Het
Slc33a1 A G 3: 63,855,039 (GRCm39) F407S possibly damaging Het
Slc38a4 A C 15: 96,906,545 (GRCm39) L356R probably damaging Het
Slc43a1 T A 2: 84,687,215 (GRCm39) L372Q probably damaging Het
Slc6a6 T A 6: 91,716,946 (GRCm39) I274N probably damaging Het
Spata33 T C 8: 123,941,146 (GRCm39) F65S unknown Het
Spmip5 A T 19: 58,781,174 (GRCm39) Y25N probably damaging Het
Stx19 A G 16: 62,642,567 (GRCm39) T128A probably benign Het
Tas2r103 T C 6: 133,013,812 (GRCm39) M85V probably benign Het
Tas2r117 C T 6: 132,780,485 (GRCm39) L208F probably damaging Het
Tcirg1 A T 19: 3,952,900 (GRCm39) I233N possibly damaging Het
Uba6 C A 5: 86,300,779 (GRCm39) W192L probably benign Het
Ube3a T C 7: 58,938,525 (GRCm39) I761T probably damaging Het
Unc80 T C 1: 66,549,754 (GRCm39) S671P possibly damaging Het
Usp8 A G 2: 126,593,043 (GRCm39) Q766R probably damaging Het
Vmn2r103 A G 17: 20,032,314 (GRCm39) N696S probably damaging Het
Vmn2r14 G A 5: 109,368,086 (GRCm39) T302I probably benign Het
Vmn2r50 G A 7: 9,771,298 (GRCm39) A801V probably damaging Het
Vmn2r85 T G 10: 130,254,562 (GRCm39) Q707H probably damaging Het
Wsb2 G A 5: 117,501,787 (GRCm39) V51M probably benign Het
Xdh T C 17: 74,246,831 (GRCm39) T78A probably benign Het
Zfp442 T C 2: 150,250,241 (GRCm39) K554E possibly damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTGGGACCAAATAAATC -3'
(R):5'- CCACATTTTGTCTGATGGTACTAG -3'

Sequencing Primer
(F):5'- TGGGACCAAATAAATCCTCTGG -3'
(R):5'- CTGGAGTTACTGACACTGAGCTAC -3'
Posted On 2019-11-26