Mutagenetix > Incidental Mutation

Incidental Mutation 'R7768:Smchd1'

598424

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R7768 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 71411911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 821 (G821D)

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

AlphaFold

Q6P5D8

Predicted Effect

probably damaging
Transcript: ENSMUST00000127430
AA Change: G821D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: G821D

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	A	T	19: 58,792,742	Y25N	probably damaging	Het
Actn2	A	G	13: 12,282,594	V479A	possibly damaging	Het
Acy1	G	A	9: 106,433,618	T317M	possibly damaging	Het
Adgrg6	A	T	10: 14,431,666	D797E	probably benign	Het
Ank1	C	T	8: 23,097,997	A552V	probably benign	Het
Ankrd13c	A	G	3: 157,988,647	T262A	probably benign	Het
Ap4e1	A	T	2: 127,046,934	N468Y	probably damaging	Het
Apbb1	T	C	7: 105,567,088	I367V	probably benign	Het
Arl6	A	G	16: 59,632,336	I33T	probably damaging	Het
Asgr2	T	C	11: 70,105,416	I228T	probably damaging	Het
Aspn	A	G	13: 49,557,395	H172R	probably damaging	Het
Bclaf1	T	A	10: 20,339,771	F868L	probably benign	Het
Cacna1i	G	A	15: 80,381,188	R1547H	probably damaging	Het
Celsr1	G	T	15: 85,932,409	Q1778K	probably benign	Het
Cep250	T	C	2: 155,986,009	L42S		Het
Clnk	C	A	5: 38,768,158	R100L	probably damaging	Het
Cpvl	A	G	6: 53,896,491	V420A	possibly damaging	Het
Dicer1	C	A	12: 104,706,697	G825V	probably damaging	Het
Dmxl2	T	C	9: 54,380,939	Y2628C	probably damaging	Het
Dnah7b	T	A	1: 46,137,474	H751Q	probably benign	Het
Dnhd1	C	A	7: 105,721,095	R4576S	possibly damaging	Het
Dzip1	A	T	14: 118,879,498	D775E	probably benign	Het
Erich3	T	A	3: 154,748,331	M381K	probably benign	Het
Fam193a	A	G	5: 34,465,791	D1241G	possibly damaging	Het
Gbx2	A	G	1: 89,928,984	L228P	probably benign	Het
Ggt7	A	T	2: 155,506,501	M77K	possibly damaging	Het
Gm12800	A	C	4: 101,911,813	I454L	probably benign	Het
Gpr26	T	A	7: 131,974,348	I247K	probably damaging	Het
Grip1	A	G	10: 120,038,397	T745A	probably damaging	Het
Gusb	A	T	5: 130,000,405	H178Q	probably benign	Het
Hacl1	T	C	14: 31,616,480	Y380C	probably damaging	Het
Hdac9	T	C	12: 34,390,240	H380R	possibly damaging	Het
Icam4	T	A	9: 21,029,994	L143Q	probably damaging	Het
Ikbkb	T	A	8: 22,695,236	I43F	probably damaging	Het
Ints11	G	T	4: 155,886,939	K303N	probably damaging	Het
Itpa	A	T	2: 130,667,916	N16I	probably damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kat6a	T	A	8: 22,903,212	N235K	probably damaging	Het
Kmt2a	C	T	9: 44,820,603	V2806I	unknown	Het
Loxhd1	T	A	18: 77,384,941	F1051L	probably damaging	Het
Map2	A	G	1: 66,414,483	E844G	possibly damaging	Het
Mmp7	T	A	9: 7,697,748	Y261*	probably null	Het
Muc4	A	C	16: 32,756,194	M2023L	unknown	Het
Mybpc1	C	A	10: 88,542,372	G688V	probably damaging	Het
Myo3a	A	G	2: 22,241,143	T34A	probably damaging	Het
Nrxn2	A	G	19: 6,481,379	T683A	possibly damaging	Het
Nup160	A	G	2: 90,700,116	I444V	probably damaging	Het
Olfr1132	T	C	2: 87,635,313	M145V	probably benign	Het
Olfr1291-ps1	A	C	2: 111,499,853	K200N	possibly damaging	Het
Olfr329-ps	A	T	11: 58,542,640	S292T	probably damaging	Het
Olfr329-ps	A	T	11: 58,542,867	M216K	possibly damaging	Het
Pcdha1	A	G	18: 36,932,167	E628G	probably damaging	Het
Pcdha12	T	C	18: 37,022,351	S708P	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Pkd1l2	A	G	8: 117,054,860		probably null	Het
Pla2g6	T	C	15: 79,297,314	D577G	probably damaging	Het
Pla2r1	G	T	2: 60,448,946	D763E	probably benign	Het
Psg18	A	T	7: 18,346,028	I416N	probably damaging	Het
Rapgef6	G	T	11: 54,626,588	V369F	probably damaging	Het
Rasal3	T	C	17: 32,396,793	E357G	probably damaging	Het
Rhbdl3	G	A	11: 80,330,621	R195Q	probably benign	Het
Rnf216	A	T	5: 143,098,444	M1K	probably null	Het
Rspry1	C	A	8: 94,629,841	D165E	probably damaging	Het
Rwdd2b	G	A	16: 87,436,745	L156F	probably benign	Het
Scn11a	T	A	9: 119,815,272	I141F	probably benign	Het
Sirt2	A	T	7: 28,782,859	T198S	probably benign	Het
Slc2a1	A	G	4: 119,132,447	N94D	probably damaging	Het
Slc33a1	A	G	3: 63,947,618	F407S	possibly damaging	Het
Slc38a4	A	C	15: 97,008,664	L356R	probably damaging	Het
Slc43a1	T	A	2: 84,856,871	L372Q	probably damaging	Het
Slc6a6	T	A	6: 91,739,965	I274N	probably damaging	Het
Spata33	T	C	8: 123,214,407	F65S	unknown	Het
Stx19	A	G	16: 62,822,204	T128A	probably benign	Het
Tas2r103	T	C	6: 133,036,849	M85V	probably benign	Het
Tas2r117	C	T	6: 132,803,522	L208F	probably damaging	Het
Tcirg1	A	T	19: 3,902,900	I233N	possibly damaging	Het
Uba6	C	A	5: 86,152,920	W192L	probably benign	Het
Ube3a	T	C	7: 59,288,777	I761T	probably damaging	Het
Unc80	T	C	1: 66,510,595	S671P	possibly damaging	Het
Usp8	A	G	2: 126,751,123	Q766R	probably damaging	Het
Vmn2r103	A	G	17: 19,812,052	N696S	probably damaging	Het
Vmn2r14	G	A	5: 109,220,220	T302I	probably benign	Het
Vmn2r50	G	A	7: 10,037,371	A801V	probably damaging	Het
Vmn2r85	T	G	10: 130,418,693	Q707H	probably damaging	Het
Wsb2	G	A	5: 117,363,722	V51M	probably benign	Het
Xdh	T	C	17: 73,939,836	T78A	probably benign	Het
Zfp442	T	C	2: 150,408,321	K554E	possibly damaging	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
Dry_tortugas	UTSW	17	71440956	missense	probably damaging	1.00
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1120:Smchd1	UTSW	17	71358146	nonsense	probably null
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1473:Smchd1	UTSW	17	71361837	splice site	probably benign
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6082:Smchd1	UTSW	17	71349719	missense	probably benign	0.09
R6126:Smchd1	UTSW	17	71370285	missense	probably damaging	1.00
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7085:Smchd1	UTSW	17	71365219	splice site	probably null
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
R8948:Smchd1	UTSW	17	71436772	missense	probably damaging	1.00
R8954:Smchd1	UTSW	17	71448757	missense	probably damaging	1.00
R9041:Smchd1	UTSW	17	71394715	critical splice donor site	probably null
R9054:Smchd1	UTSW	17	71363022	nonsense	probably null
R9141:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9169:Smchd1	UTSW	17	71415664	missense	probably damaging	1.00
R9231:Smchd1	UTSW	17	71365089	missense	probably benign	0.05
R9368:Smchd1	UTSW	17	71387076	missense	probably damaging	1.00
R9374:Smchd1	UTSW	17	71411848	missense	possibly damaging	0.61
R9416:Smchd1	UTSW	17	71394796	missense	probably benign	0.27
R9426:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9491:Smchd1	UTSW	17	71360025	critical splice donor site	probably null
R9511:Smchd1	UTSW	17	71443904	missense	possibly damaging	0.65
R9591:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
R9593:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCCTGGGACCAAATAAATC -3'
(R):5'- CCACATTTTGTCTGATGGTACTAG -3'

Sequencing Primer
(F):5'- TGGGACCAAATAAATCCTCTGG -3'
(R):5'- CTGGAGTTACTGACACTGAGCTAC -3'

Posted On

2019-11-26