Incidental Mutation 'R7768:Smchd1'
ID598424
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R7768 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71411911 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 821 (G821D)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: G821D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: G821D

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Acy1 G A 9: 106,433,618 T317M possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dmxl2 T C 9: 54,380,939 Y2628C probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd1l2 A G 8: 117,054,860 probably null Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Psg18 A T 7: 18,346,028 I416N probably damaging Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc33a1 A G 3: 63,947,618 F407S possibly damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Usp8 A G 2: 126,751,123 Q766R probably damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71475301 start gained probably benign
R7898:Smchd1 UTSW 17 71377818 splice site probably null
R7965:Smchd1 UTSW 17 71455626 missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71390453 missense probably benign 0.28
R8359:Smchd1 UTSW 17 71431243 missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71394913 missense probably benign 0.22
R8426:Smchd1 UTSW 17 71448603 missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71407249 missense probably benign 0.18
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTGGGACCAAATAAATC -3'
(R):5'- CCACATTTTGTCTGATGGTACTAG -3'

Sequencing Primer
(F):5'- TGGGACCAAATAAATCCTCTGG -3'
(R):5'- CTGGAGTTACTGACACTGAGCTAC -3'
Posted On2019-11-26