Mutagenetix > Incidental Mutations

Incidental Mutation 'R7768:Nrxn2'

598430

Institutional Source

Beutler Lab

Gene Symbol

Nrxn2

Ensembl Gene

ENSMUSG00000033768

Gene Name

neurexin II

Synonyms

6430591O13Rik, neurexin II beta, neurexin II alpha

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7768 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

6418731-6544169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6481379 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 683 (T683A)

Ref Sequence

ENSEMBL: ENSMUSP00000109089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166]

Predicted Effect

probably benign
Transcript: ENSMUST00000077182
AA Change: T675A

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: T675A

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	444	1.18e-33	SMART
LamG	498	651	1.51e-40	SMART
EGF	678	712	8.91e-3	SMART
LamG	737	875	4.91e-22	SMART
LamG	923	1059	1.08e-41	SMART
EGF	1084	1118	1.91e1	SMART
LamG	1146	1303	4.48e-16	SMART
low complexity region	1332	1362	N/A	INTRINSIC
low complexity region	1430	1445	N/A	INTRINSIC
4.1m	1448	1466	3.75e-4	SMART
low complexity region	1480	1499	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113461
AA Change: T659A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: T659A

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
LamG	286	428	8.4e-30	SMART
LamG	482	635	1.51e-40	SMART
EGF	662	696	8.91e-3	SMART
LamG	721	850	2.36e-24	SMART
LamG	898	1034	1.08e-41	SMART
EGF	1059	1093	1.91e1	SMART
LamG	1121	1248	1.26e-19	SMART
low complexity region	1277	1307	N/A	INTRINSIC
low complexity region	1363	1384	N/A	INTRINSIC
low complexity region	1567	1582	N/A	INTRINSIC
4.1m	1585	1603	3.75e-4	SMART
low complexity region	1617	1636	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113462
AA Change: T683A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: T683A

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	452	8.4e-30	SMART
LamG	506	659	1.51e-40	SMART
EGF	686	720	8.91e-3	SMART
LamG	745	883	4.91e-22	SMART
LamG	931	1067	1.08e-41	SMART
EGF	1092	1126	1.91e1	SMART
LamG	1154	1311	4.48e-16	SMART
low complexity region	1340	1370	N/A	INTRINSIC
low complexity region	1426	1447	N/A	INTRINSIC
low complexity region	1630	1645	N/A	INTRINSIC
4.1m	1648	1666	3.75e-4	SMART
low complexity region	1680	1699	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137166
AA Change: T690A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: T690A

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
LamG	49	187	1.67e-33	SMART
EGF	205	242	1.73e1	SMART
low complexity region	268	276	N/A	INTRINSIC
LamG	310	459	8.87e-29	SMART
LamG	513	666	1.51e-40	SMART
EGF	693	727	8.91e-3	SMART
LamG	752	890	4.91e-22	SMART
LamG	938	1074	1.08e-41	SMART
EGF	1099	1133	1.91e1	SMART
LamG	1161	1318	4.48e-16	SMART
low complexity region	1347	1377	N/A	INTRINSIC
low complexity region	1433	1454	N/A	INTRINSIC
low complexity region	1637	1652	N/A	INTRINSIC
4.1m	1655	1673	3.75e-4	SMART
low complexity region	1687	1706	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	A	T	19: 58,792,742	Y25N	probably damaging	Het
Actn2	A	G	13: 12,282,594	V479A	possibly damaging	Het
Acy1	G	A	9: 106,433,618	T317M	possibly damaging	Het
Adgrg6	A	T	10: 14,431,666	D797E	probably benign	Het
Ank1	C	T	8: 23,097,997	A552V	probably benign	Het
Ankrd13c	A	G	3: 157,988,647	T262A	probably benign	Het
Ap4e1	A	T	2: 127,046,934	N468Y	probably damaging	Het
Apbb1	T	C	7: 105,567,088	I367V	probably benign	Het
Arl6	A	G	16: 59,632,336	I33T	probably damaging	Het
Asgr2	T	C	11: 70,105,416	I228T	probably damaging	Het
Aspn	A	G	13: 49,557,395	H172R	probably damaging	Het
Bclaf1	T	A	10: 20,339,771	F868L	probably benign	Het
Cacna1i	G	A	15: 80,381,188	R1547H	probably damaging	Het
Celsr1	G	T	15: 85,932,409	Q1778K	probably benign	Het
Cep250	T	C	2: 155,986,009	L42S		Het
Clnk	C	A	5: 38,768,158	R100L	probably damaging	Het
Cpvl	A	G	6: 53,896,491	V420A	possibly damaging	Het
Dicer1	C	A	12: 104,706,697	G825V	probably damaging	Het
Dmxl2	T	C	9: 54,380,939	Y2628C	probably damaging	Het
Dnah7b	T	A	1: 46,137,474	H751Q	probably benign	Het
Dnhd1	C	A	7: 105,721,095	R4576S	possibly damaging	Het
Dzip1	A	T	14: 118,879,498	D775E	probably benign	Het
Erich3	T	A	3: 154,748,331	M381K	probably benign	Het
Fam193a	A	G	5: 34,465,791	D1241G	possibly damaging	Het
Gbx2	A	G	1: 89,928,984	L228P	probably benign	Het
Ggt7	A	T	2: 155,506,501	M77K	possibly damaging	Het
Gm12800	A	C	4: 101,911,813	I454L	probably benign	Het
Gpr26	T	A	7: 131,974,348	I247K	probably damaging	Het
Grip1	A	G	10: 120,038,397	T745A	probably damaging	Het
Gusb	A	T	5: 130,000,405	H178Q	probably benign	Het
Hacl1	T	C	14: 31,616,480	Y380C	probably damaging	Het
Hdac9	T	C	12: 34,390,240	H380R	possibly damaging	Het
Icam4	T	A	9: 21,029,994	L143Q	probably damaging	Het
Ikbkb	T	A	8: 22,695,236	I43F	probably damaging	Het
Ints11	G	T	4: 155,886,939	K303N	probably damaging	Het
Itpa	A	T	2: 130,667,916	N16I	probably damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kat6a	T	A	8: 22,903,212	N235K	probably damaging	Het
Kmt2a	C	T	9: 44,820,603	V2806I	unknown	Het
Loxhd1	T	A	18: 77,384,941	F1051L	probably damaging	Het
Map2	A	G	1: 66,414,483	E844G	possibly damaging	Het
Mmp7	T	A	9: 7,697,748	Y261*	probably null	Het
Muc4	A	C	16: 32,756,194	M2023L	unknown	Het
Mybpc1	C	A	10: 88,542,372	G688V	probably damaging	Het
Myo3a	A	G	2: 22,241,143	T34A	probably damaging	Het
Nup160	A	G	2: 90,700,116	I444V	probably damaging	Het
Olfr1132	T	C	2: 87,635,313	M145V	probably benign	Het
Olfr1291-ps1	A	C	2: 111,499,853	K200N	possibly damaging	Het
Olfr329-ps	A	T	11: 58,542,640	S292T	probably damaging	Het
Olfr329-ps	A	T	11: 58,542,867	M216K	possibly damaging	Het
Pcdha1	A	G	18: 36,932,167	E628G	probably damaging	Het
Pcdha12	T	C	18: 37,022,351	S708P	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	not run	Het
Pkd1l2	A	G	8: 117,054,860		probably null	Het
Pla2g6	T	C	15: 79,297,314	D577G	probably damaging	Het
Pla2r1	G	T	2: 60,448,946	D763E	probably benign	Het
Psg18	A	T	7: 18,346,028	I416N	probably damaging	Het
Rapgef6	G	T	11: 54,626,588	V369F	probably damaging	Het
Rasal3	T	C	17: 32,396,793	E357G	probably damaging	Het
Rhbdl3	G	A	11: 80,330,621	R195Q	probably benign	Het
Rnf216	A	T	5: 143,098,444	M1K	probably null	Het
Rspry1	C	A	8: 94,629,841	D165E	probably damaging	Het
Rwdd2b	G	A	16: 87,436,745	L156F	probably benign	Het
Scn11a	T	A	9: 119,815,272	I141F	probably benign	Het
Sirt2	A	T	7: 28,782,859	T198S	probably benign	Het
Slc2a1	A	G	4: 119,132,447	N94D	probably damaging	Het
Slc33a1	A	G	3: 63,947,618	F407S	possibly damaging	Het
Slc38a4	A	C	15: 97,008,664	L356R	probably damaging	Het
Slc43a1	T	A	2: 84,856,871	L372Q	probably damaging	Het
Slc6a6	T	A	6: 91,739,965	I274N	probably damaging	Het
Smchd1	C	T	17: 71,411,911	G821D	probably damaging	Het
Spata33	T	C	8: 123,214,407	F65S	unknown	Het
Stx19	A	G	16: 62,822,204	T128A	probably benign	Het
Tas2r103	T	C	6: 133,036,849	M85V	probably benign	Het
Tas2r117	C	T	6: 132,803,522	L208F	probably damaging	Het
Tcirg1	A	T	19: 3,902,900	I233N	possibly damaging	Het
Uba6	C	A	5: 86,152,920	W192L	probably benign	Het
Ube3a	T	C	7: 59,288,777	I761T	probably damaging	Het
Unc80	T	C	1: 66,510,595	S671P	possibly damaging	Het
Usp8	A	G	2: 126,751,123	Q766R	probably damaging	Het
Vmn2r103	A	G	17: 19,812,052	N696S	probably damaging	Het
Vmn2r14	G	A	5: 109,220,220	T302I	probably benign	Het
Vmn2r50	G	A	7: 10,037,371	A801V	probably damaging	Het
Vmn2r85	T	G	10: 130,418,693	Q707H	probably damaging	Het
Wsb2	G	A	5: 117,363,722	V51M	probably benign	Het
Xdh	T	C	17: 73,939,836	T78A	probably benign	Het
Zfp442	T	C	2: 150,408,321	K554E	possibly damaging	Het

Other mutations in Nrxn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nrxn2	APN	19	6473593	missense	possibly damaging	0.84
IGL01020:Nrxn2	APN	19	6493443	missense	probably benign	0.02
IGL01064:Nrxn2	APN	19	6517053	missense	probably damaging	0.97
IGL01561:Nrxn2	APN	19	6490142	missense	probably damaging	1.00
IGL01759:Nrxn2	APN	19	6509929	missense	probably damaging	1.00
IGL02071:Nrxn2	APN	19	6481753	missense	probably damaging	1.00
IGL02085:Nrxn2	APN	19	6492868	missense	possibly damaging	0.83
IGL02132:Nrxn2	APN	19	6472276	missense	probably damaging	1.00
IGL02476:Nrxn2	APN	19	6454985	missense	probably damaging	1.00
IGL02605:Nrxn2	APN	19	6450580	missense	probably benign	0.02
IGL03123:Nrxn2	APN	19	6481737	missense	probably damaging	0.98
IGL03288:Nrxn2	APN	19	6490696	missense	probably damaging	1.00
PIT4687001:Nrxn2	UTSW	19	6481308	missense	probably benign	0.06
R0019:Nrxn2	UTSW	19	6509957	splice site	probably benign
R0257:Nrxn2	UTSW	19	6490698	missense	possibly damaging	0.81
R0305:Nrxn2	UTSW	19	6519283	missense	probably damaging	1.00
R0453:Nrxn2	UTSW	19	6491521	missense	probably damaging	1.00
R0512:Nrxn2	UTSW	19	6517198	missense	probably damaging	1.00
R0539:Nrxn2	UTSW	19	6493404	missense	probably damaging	0.99
R0571:Nrxn2	UTSW	19	6473533	missense	probably damaging	1.00
R1373:Nrxn2	UTSW	19	6472301	missense	probably damaging	1.00
R1434:Nrxn2	UTSW	19	6443612	intron	probably null
R1454:Nrxn2	UTSW	19	6481446	missense	probably damaging	0.98
R1671:Nrxn2	UTSW	19	6473750	missense	probably damaging	1.00
R1692:Nrxn2	UTSW	19	6519268	missense	probably damaging	1.00
R1858:Nrxn2	UTSW	19	6488795	missense	probably benign	0.01
R1859:Nrxn2	UTSW	19	6488795	missense	probably benign	0.01
R2153:Nrxn2	UTSW	19	6504914	missense	probably damaging	1.00
R2196:Nrxn2	UTSW	19	6490109	missense	probably damaging	1.00
R2209:Nrxn2	UTSW	19	6493007	missense	probably benign	0.01
R2278:Nrxn2	UTSW	19	6481853	missense	probably damaging	1.00
R2441:Nrxn2	UTSW	19	6428301	missense	probably damaging	1.00
R3897:Nrxn2	UTSW	19	6519257	missense	probably damaging	1.00
R3943:Nrxn2	UTSW	19	6473335	missense	probably damaging	1.00
R4091:Nrxn2	UTSW	19	6473414	missense	probably damaging	1.00
R4162:Nrxn2	UTSW	19	6532143	missense	probably damaging	1.00
R4164:Nrxn2	UTSW	19	6532143	missense	probably damaging	1.00
R4495:Nrxn2	UTSW	19	6531399	missense	probably benign	0.05
R4599:Nrxn2	UTSW	19	6455252	missense	probably damaging	0.98
R4735:Nrxn2	UTSW	19	6498454	missense	possibly damaging	0.86
R4757:Nrxn2	UTSW	19	6509821	missense	probably damaging	1.00
R4890:Nrxn2	UTSW	19	6448278	missense	possibly damaging	0.90
R5052:Nrxn2	UTSW	19	6455204	missense	probably damaging	1.00
R5311:Nrxn2	UTSW	19	6531398	missense	probably benign	0.05
R5330:Nrxn2	UTSW	19	6490081	missense	probably damaging	0.96
R5331:Nrxn2	UTSW	19	6490081	missense	probably damaging	0.96
R5530:Nrxn2	UTSW	19	6498367	missense	possibly damaging	0.93
R5556:Nrxn2	UTSW	19	6490091	missense	probably damaging	1.00
R5763:Nrxn2	UTSW	19	6531339	missense	probably benign	0.15
R5829:Nrxn2	UTSW	19	6490849	missense	probably benign	0.03
R5988:Nrxn2	UTSW	19	6492871	missense	possibly damaging	0.83
R6003:Nrxn2	UTSW	19	6498328	missense	possibly damaging	0.93
R6032:Nrxn2	UTSW	19	6517132	missense	probably damaging	1.00
R6032:Nrxn2	UTSW	19	6517132	missense	probably damaging	1.00
R6288:Nrxn2	UTSW	19	6490561	missense	probably damaging	1.00
R6334:Nrxn2	UTSW	19	6531292	unclassified	probably null
R6373:Nrxn2	UTSW	19	6509830	missense	probably damaging	1.00
R6397:Nrxn2	UTSW	19	6532122	missense	probably damaging	1.00
R6669:Nrxn2	UTSW	19	6481191	missense	probably damaging	1.00
R6980:Nrxn2	UTSW	19	6450579	missense	probably benign	0.04
R6985:Nrxn2	UTSW	19	6481245	missense	probably damaging	1.00
R7184:Nrxn2	UTSW	19	6490552	missense	probably damaging	1.00
R7361:Nrxn2	UTSW	19	6517082	missense	probably benign	0.00
R7576:Nrxn2	UTSW	19	6531510	nonsense	probably null
R7604:Nrxn2	UTSW	19	6531961	missense	probably damaging	1.00
R7631:Nrxn2	UTSW	19	6481795	missense	possibly damaging	0.83
R7805:Nrxn2	UTSW	19	6531706	missense	probably benign
R7896:Nrxn2	UTSW	19	6532053	missense	possibly damaging	0.89
R7979:Nrxn2	UTSW	19	6532053	missense	possibly damaging	0.89
R7998:Nrxn2	UTSW	19	6509875	missense	probably damaging	0.98
X0022:Nrxn2	UTSW	19	6509917	missense	probably damaging	1.00
Z1177:Nrxn2	UTSW	19	6498517	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAGAGTGAGCTGTACCTG -3'
(R):5'- CAGCCTGAGGTTTACTCTGAAGAG -3'

Sequencing Primer
(F):5'- TGTACCTGGGCGGTCTC -3'
(R):5'- TTACTCTGAAGAGGAAGGAAGCATC -3'

Posted On

2019-11-26