Incidental Mutation 'R7769:Arhgef38'
ID598451
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene NameRho guanine nucleotide exchange factor (GEF) 38
SynonymsD630013G24Rik, 9130221D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7769 (G1)
Quality Score160.009
Status Validated
Chromosome3
Chromosomal Location133112278-133234949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 133149622 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 235 (S235A)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147041]
Predicted Effect unknown
Transcript: ENSMUST00000147041
AA Change: S235A
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: S235A

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Abhd14b T C 9: 106,451,620 Y147H probably damaging Het
Adam26b C A 8: 43,521,695 R90L probably benign Het
Agt A T 8: 124,564,550 M6K probably benign Het
Akr1c14 T C 13: 4,059,644 S5P probably benign Het
Cabp5 A G 7: 13,400,733 D31G probably benign Het
Cacna1h T A 17: 25,385,805 D1178V probably damaging Het
Ccdc88a A T 11: 29,482,381 E1199D probably damaging Het
Cd244 A T 1: 171,577,305 I242F probably benign Het
Clpb G T 7: 101,722,717 R220L probably damaging Het
Cltc C T 11: 86,719,493 R638H probably damaging Het
Cnr1 A T 4: 33,944,892 M427L probably benign Het
Ctnnbl1 C T 2: 157,737,470 probably benign Het
Epb41l2 A T 10: 25,493,573 T597S probably benign Het
Epb41l3 T C 17: 69,238,426 Y163H probably damaging Het
Fam129b A G 2: 32,919,832 T314A possibly damaging Het
Fgg A G 3: 83,013,126 probably null Het
Gm37240 A T 3: 84,509,925 D162E possibly damaging Het
Gm44511 T A 6: 128,820,277 T83S probably benign Het
Gm6685 T A 11: 28,339,252 Y188F probably benign Het
Gprin2 A T 14: 34,195,613 C67S probably benign Het
Grk6 A G 13: 55,451,007 D140G probably benign Het
Hps3 T C 3: 20,018,808 probably null Het
Hspb7 T C 4: 141,424,024 V159A possibly damaging Het
Ibsp A G 5: 104,306,005 N70D probably benign Het
Ibsp A G 5: 104,310,184 N196D probably damaging Het
Igfn1 A T 1: 135,982,405 F147Y possibly damaging Het
Iqca T G 1: 90,077,810 D492A possibly damaging Het
Klhl42 T C 6: 147,091,860 L110P possibly damaging Het
Krt12 C T 11: 99,418,026 R395Q probably damaging Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Mttp A C 3: 138,103,112 L730R probably damaging Het
Muc16 T A 9: 18,660,507 I239L unknown Het
Myo15 T C 11: 60,509,149 F1723L Het
Nin T C 12: 70,043,230 D1137G Het
Nsf C T 11: 103,928,839 V35M probably damaging Het
Numa1 T A 7: 101,999,000 I646K possibly damaging Het
Nwd2 A G 5: 63,804,504 N477S probably damaging Het
Olfr59 T A 11: 74,288,763 V39E probably damaging Het
P4ha3 A G 7: 100,285,717 D62G probably damaging Het
Palb2 G T 7: 122,128,415 D77E probably benign Het
Pcmtd2 T C 2: 181,851,701 V233A probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr C T 9: 8,946,855 T699I possibly damaging Het
Pknox2 C A 9: 36,895,306 probably null Het
Ppp2r3d T C 9: 124,439,087 H110R Het
Psmd11 T A 11: 80,434,582 probably benign Het
Pyroxd2 T C 19: 42,747,562 N59S probably benign Het
Qser1 A T 2: 104,758,576 D1662E possibly damaging Het
Rasip1 A G 7: 45,628,815 Y180C probably damaging Het
Rbl1 T C 2: 157,191,980 S393G probably benign Het
Rtn4r C T 16: 18,151,289 P194S probably benign Het
Ryr1 C T 7: 29,098,785 G944D probably damaging Het
Scamp3 A G 3: 89,177,991 D23G probably damaging Het
Secisbp2l CTGGG C 2: 125,771,545 probably benign Het
Shcbp1 A G 8: 4,739,232 I529T probably damaging Het
Slc5a10 T A 11: 61,673,647 D502V probably damaging Het
Smad5 T C 13: 56,733,042 I323T possibly damaging Het
Spred1 T C 2: 117,177,449 S279P probably benign Het
Stag1 T A 9: 100,944,827 V949D possibly damaging Het
Stxbp3 A G 3: 108,800,828 S386P probably benign Het
Syt14 A G 1: 192,984,324 S91P unknown Het
Thpo C T 16: 20,725,651 A211T probably benign Het
Tns1 T A 1: 73,953,371 D716V probably damaging Het
Trbv26 A G 6: 41,227,547 Y8C probably benign Het
Tshr A G 12: 91,538,270 I661V probably damaging Het
Uvrag G A 7: 98,979,721 P380S probably damaging Het
Vkorc1 G T 7: 127,894,524 Y88* probably null Het
Vmn1r63 C T 7: 5,803,370 V88M probably damaging Het
Wdsub1 A G 2: 59,878,419 Y37H probably damaging Het
Zap70 A G 1: 36,770,902 D31G probably benign Het
Zc3h12d G A 10: 7,867,626 A387T probably benign Het
Zfp438 C T 18: 5,213,377 R527H possibly damaging Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 splice site probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R8050:Arhgef38 UTSW 3 133137562 nonsense probably null
R8471:Arhgef38 UTSW 3 133234711 missense probably damaging 1.00
Z1177:Arhgef38 UTSW 3 133206961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTGTTCAAACACTGTGACAC -3'
(R):5'- AAAACACATCCTGACGCTGG -3'

Sequencing Primer
(F):5'- CTACTATCGTGGGGAATAGTCAGCC -3'
(R):5'- TCCTGACGCTGGTATAAAGC -3'
Posted On2019-11-26