Mutagenetix > Incidental Mutations

Incidental Mutation 'R7769:Clpb'

598468

Institutional Source

Beutler Lab

Gene Symbol

Clpb

Ensembl Gene

ENSMUSG00000001829

Gene Name

ClpB caseinolytic peptidase B

Synonyms

Skd3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R7769 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101663633-101795506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 101722717 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 220 (R220L)

Ref Sequence

ENSEMBL: ENSMUSP00000001884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000209579]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001884
AA Change: R220L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: R220L

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	235	264	6.65e-6	SMART
low complexity region	294	306	N/A	INTRINSIC
AAA	343	497	6.36e-10	SMART
ClpB_D2-small	541	630	6.83e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106998
AA Change: R250L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: R250L

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	265	294	6.65e-6	SMART
low complexity region	324	336	N/A	INTRINSIC
AAA	373	527	6.36e-10	SMART
ClpB_D2-small	571	660	6.83e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000209579
AA Change: R220L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (71/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	ACCAGCCC	ACC	14: 118,615,270		probably null	Het
Abhd14b	T	C	9: 106,451,620	Y147H	probably damaging	Het
Adam26b	C	A	8: 43,521,695	R90L	probably benign	Het
Agt	A	T	8: 124,564,550	M6K	probably benign	Het
Akr1c14	T	C	13: 4,059,644	S5P	probably benign	Het
Arhgef38	A	C	3: 133,149,622	S235A	unknown	Het
Cabp5	A	G	7: 13,400,733	D31G	probably benign	Het
Cacna1h	T	A	17: 25,385,805	D1178V	probably damaging	Het
Ccdc88a	A	T	11: 29,482,381	E1199D	probably damaging	Het
Cd244	A	T	1: 171,577,305	I242F	probably benign	Het
Cltc	C	T	11: 86,719,493	R638H	probably damaging	Het
Cnr1	A	T	4: 33,944,892	M427L	probably benign	Het
Ctnnbl1	C	T	2: 157,737,470		probably benign	Het
Epb41l2	A	T	10: 25,493,573	T597S	probably benign	Het
Epb41l3	T	C	17: 69,238,426	Y163H	probably damaging	Het
Fam129b	A	G	2: 32,919,832	T314A	possibly damaging	Het
Fgg	A	G	3: 83,013,126		probably null	Het
Gm37240	A	T	3: 84,509,925	D162E	possibly damaging	Het
Gm44511	T	A	6: 128,820,277	T83S	probably benign	Het
Gm6685	T	A	11: 28,339,252	Y188F	probably benign	Het
Gprin2	A	T	14: 34,195,613	C67S	probably benign	Het
Grk6	A	G	13: 55,451,007	D140G	probably benign	Het
Hps3	T	C	3: 20,018,808		probably null	Het
Hspb7	T	C	4: 141,424,024	V159A	possibly damaging	Het
Ibsp	A	G	5: 104,306,005	N70D	probably benign	Het
Ibsp	A	G	5: 104,310,184	N196D	probably damaging	Het
Igfn1	A	T	1: 135,982,405	F147Y	possibly damaging	Het
Iqca	T	G	1: 90,077,810	D492A	possibly damaging	Het
Klhl42	T	C	6: 147,091,860	L110P	possibly damaging	Het
Krt12	C	T	11: 99,418,026	R395Q	probably damaging	Het
Lig4	A	T	8: 9,973,629	H50Q	possibly damaging	Het
Mttp	A	C	3: 138,103,112	L730R	probably damaging	Het
Muc16	T	A	9: 18,660,507	I239L	unknown	Het
Myo15	T	C	11: 60,509,149	F1723L		Het
Nin	T	C	12: 70,043,230	D1137G		Het
Nsf	C	T	11: 103,928,839	V35M	probably damaging	Het
Numa1	T	A	7: 101,999,000	I646K	possibly damaging	Het
Nwd2	A	G	5: 63,804,504	N477S	probably damaging	Het
Olfr59	T	A	11: 74,288,763	V39E	probably damaging	Het
P4ha3	A	G	7: 100,285,717	D62G	probably damaging	Het
Palb2	G	T	7: 122,128,415	D77E	probably benign	Het
Pcmtd2	T	C	2: 181,851,701	V233A	probably benign	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Pgr	C	T	9: 8,946,855	T699I	possibly damaging	Het
Pknox2	C	A	9: 36,895,306		probably null	Het
Ppp2r3d	T	C	9: 124,439,087	H110R		Het
Psmd11	T	A	11: 80,434,582		probably benign	Het
Pyroxd2	T	C	19: 42,747,562	N59S	probably benign	Het
Qser1	A	T	2: 104,758,576	D1662E	possibly damaging	Het
Rasip1	A	G	7: 45,628,815	Y180C	probably damaging	Het
Rbl1	T	C	2: 157,191,980	S393G	probably benign	Het
Rtn4r	C	T	16: 18,151,289	P194S	probably benign	Het
Ryr1	C	T	7: 29,098,785	G944D	probably damaging	Het
Scamp3	A	G	3: 89,177,991	D23G	probably damaging	Het
Secisbp2l	CTGGG	C	2: 125,771,545		probably benign	Het
Shcbp1	A	G	8: 4,739,232	I529T	probably damaging	Het
Slc5a10	T	A	11: 61,673,647	D502V	probably damaging	Het
Smad5	T	C	13: 56,733,042	I323T	possibly damaging	Het
Spred1	T	C	2: 117,177,449	S279P	probably benign	Het
Stag1	T	A	9: 100,944,827	V949D	possibly damaging	Het
Stxbp3	A	G	3: 108,800,828	S386P	probably benign	Het
Syt14	A	G	1: 192,984,324	S91P	unknown	Het
Thpo	C	T	16: 20,725,651	A211T	probably benign	Het
Tns1	T	A	1: 73,953,371	D716V	probably damaging	Het
Trbv26	A	G	6: 41,227,547	Y8C	probably benign	Het
Tshr	A	G	12: 91,538,270	I661V	probably damaging	Het
Uvrag	G	A	7: 98,979,721	P380S	probably damaging	Het
Vkorc1	G	T	7: 127,894,524	Y88*	probably null	Het
Vmn1r63	C	T	7: 5,803,370	V88M	probably damaging	Het
Wdsub1	A	G	2: 59,878,419	Y37H	probably damaging	Het
Zap70	A	G	1: 36,770,902	D31G	probably benign	Het
Zc3h12d	G	A	10: 7,867,626	A387T	probably benign	Het
Zfp438	C	T	18: 5,213,377	R527H	possibly damaging	Het

Other mutations in Clpb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Clpb	APN	7	101787745	missense	probably benign
IGL00778:Clpb	APN	7	101778608	nonsense	probably null
IGL00780:Clpb	APN	7	101778608	nonsense	probably null
IGL00951:Clpb	APN	7	101751260	missense	probably benign	0.00
IGL01374:Clpb	APN	7	101773128	missense	probably damaging	1.00
IGL01542:Clpb	APN	7	101787505	missense	probably damaging	0.98
IGL02203:Clpb	APN	7	101779337	missense	probably damaging	1.00
IGL02989:Clpb	APN	7	101779220	missense	probably damaging	1.00
IGL03088:Clpb	APN	7	101785449	nonsense	probably null
Surfeit	UTSW	7	101711465	missense	probably damaging	1.00
PIT1430001:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
PIT4486001:Clpb	UTSW	7	101663932	missense	probably benign	0.17
R0611:Clpb	UTSW	7	101787749	missense	possibly damaging	0.71
R1565:Clpb	UTSW	7	101785461	missense	probably benign	0.00
R1760:Clpb	UTSW	7	101786698	missense	possibly damaging	0.92
R1879:Clpb	UTSW	7	101706483	missense	probably benign	0.23
R1933:Clpb	UTSW	7	101779211	missense	probably damaging	0.96
R1938:Clpb	UTSW	7	101763656	missense	probably damaging	1.00
R2922:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2923:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2995:Clpb	UTSW	7	101779324	missense	probably damaging	1.00
R4492:Clpb	UTSW	7	101787722	missense	probably damaging	1.00
R5384:Clpb	UTSW	7	101779341	missense	probably damaging	1.00
R5973:Clpb	UTSW	7	101663997	missense	probably benign	0.02
R6787:Clpb	UTSW	7	101663659	unclassified	probably benign
R7158:Clpb	UTSW	7	101663832	missense	probably benign	0.45
R7225:Clpb	UTSW	7	101711465	missense	probably damaging	1.00
R7239:Clpb	UTSW	7	101711455	missense	probably damaging	0.96
R7482:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
R7499:Clpb	UTSW	7	101722728	missense	possibly damaging	0.92
R7547:Clpb	UTSW	7	101664296	splice site	probably null
R8279:Clpb	UTSW	7	101706488	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AACTTAAAATGTTGAAGAGCTAAGCA -3'
(R):5'- ATGGTGCCAGAAGAGTGGT -3'

Sequencing Primer
(F):5'- CAAGGCTAGCGTGGTCTACATG -3'
(R):5'- AGAAGAGTGGTGGCCTCTC -3'

Posted On

2019-11-26