Incidental Mutation 'R7769:Clpb'
ID598468
Institutional Source Beutler Lab
Gene Symbol Clpb
Ensembl Gene ENSMUSG00000001829
Gene NameClpB caseinolytic peptidase B
SynonymsSkd3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R7769 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location101663633-101795506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101722717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 220 (R220L)
Ref Sequence ENSEMBL: ENSMUSP00000001884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000209579]
Predicted Effect probably damaging
Transcript: ENSMUST00000001884
AA Change: R220L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: R220L

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 235 264 6.65e-6 SMART
low complexity region 294 306 N/A INTRINSIC
AAA 343 497 6.36e-10 SMART
ClpB_D2-small 541 630 6.83e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106998
AA Change: R250L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: R250L

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 265 294 6.65e-6 SMART
low complexity region 324 336 N/A INTRINSIC
AAA 373 527 6.36e-10 SMART
ClpB_D2-small 571 660 6.83e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209579
AA Change: R220L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Abhd14b T C 9: 106,451,620 Y147H probably damaging Het
Adam26b C A 8: 43,521,695 R90L probably benign Het
Agt A T 8: 124,564,550 M6K probably benign Het
Akr1c14 T C 13: 4,059,644 S5P probably benign Het
Arhgef38 A C 3: 133,149,622 S235A unknown Het
Cabp5 A G 7: 13,400,733 D31G probably benign Het
Cacna1h T A 17: 25,385,805 D1178V probably damaging Het
Ccdc88a A T 11: 29,482,381 E1199D probably damaging Het
Cd244 A T 1: 171,577,305 I242F probably benign Het
Cltc C T 11: 86,719,493 R638H probably damaging Het
Cnr1 A T 4: 33,944,892 M427L probably benign Het
Ctnnbl1 C T 2: 157,737,470 probably benign Het
Epb41l2 A T 10: 25,493,573 T597S probably benign Het
Epb41l3 T C 17: 69,238,426 Y163H probably damaging Het
Fam129b A G 2: 32,919,832 T314A possibly damaging Het
Gm37240 A T 3: 84,509,925 D162E possibly damaging Het
Gm44511 T A 6: 128,820,277 T83S probably benign Het
Gm6685 T A 11: 28,339,252 Y188F probably benign Het
Gprin2 A T 14: 34,195,613 C67S probably benign Het
Grk6 A G 13: 55,451,007 D140G probably benign Het
Hspb7 T C 4: 141,424,024 V159A possibly damaging Het
Ibsp A G 5: 104,306,005 N70D probably benign Het
Ibsp A G 5: 104,310,184 N196D probably damaging Het
Igfn1 A T 1: 135,982,405 F147Y possibly damaging Het
Iqca T G 1: 90,077,810 D492A possibly damaging Het
Klhl42 T C 6: 147,091,860 L110P possibly damaging Het
Krt12 C T 11: 99,418,026 R395Q probably damaging Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Mttp A C 3: 138,103,112 L730R probably damaging Het
Muc16 T A 9: 18,660,507 I239L unknown Het
Myo15 T C 11: 60,509,149 F1723L Het
Nin T C 12: 70,043,230 D1137G Het
Nsf C T 11: 103,928,839 V35M probably damaging Het
Numa1 T A 7: 101,999,000 I646K possibly damaging Het
Nwd2 A G 5: 63,804,504 N477S probably damaging Het
Olfr59 T A 11: 74,288,763 V39E probably damaging Het
P4ha3 A G 7: 100,285,717 D62G probably damaging Het
Palb2 G T 7: 122,128,415 D77E probably benign Het
Pcmtd2 T C 2: 181,851,701 V233A probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr C T 9: 8,946,855 T699I possibly damaging Het
Ppp2r3d T C 9: 124,439,087 H110R Het
Pyroxd2 T C 19: 42,747,562 N59S probably benign Het
Qser1 A T 2: 104,758,576 D1662E possibly damaging Het
Rasip1 A G 7: 45,628,815 Y180C probably damaging Het
Rbl1 T C 2: 157,191,980 S393G probably benign Het
Rtn4r C T 16: 18,151,289 P194S probably benign Het
Ryr1 C T 7: 29,098,785 G944D probably damaging Het
Scamp3 A G 3: 89,177,991 D23G probably damaging Het
Secisbp2l CTGGG C 2: 125,771,545 probably benign Het
Shcbp1 A G 8: 4,739,232 I529T probably damaging Het
Slc5a10 T A 11: 61,673,647 D502V probably damaging Het
Smad5 T C 13: 56,733,042 I323T possibly damaging Het
Spred1 T C 2: 117,177,449 S279P probably benign Het
Stag1 T A 9: 100,944,827 V949D possibly damaging Het
Stxbp3 A G 3: 108,800,828 S386P probably benign Het
Syt14 A G 1: 192,984,324 S91P unknown Het
Thpo C T 16: 20,725,651 A211T probably benign Het
Tns1 T A 1: 73,953,371 D716V probably damaging Het
Trbv26 A G 6: 41,227,547 Y8C probably benign Het
Tshr A G 12: 91,538,270 I661V probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Uvrag G A 7: 98,979,721 P380S probably damaging Het
Vkorc1 G T 7: 127,894,524 Y88* probably null Het
Vmn1r63 C T 7: 5,803,370 V88M probably damaging Het
Wdsub1 A G 2: 59,878,419 Y37H probably damaging Het
Zap70 A G 1: 36,770,902 D31G probably benign Het
Zc3h12d G A 10: 7,867,626 A387T probably benign Het
Zfp438 C T 18: 5,213,377 R527H possibly damaging Het
Other mutations in Clpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Clpb APN 7 101787745 missense probably benign
IGL00778:Clpb APN 7 101778608 nonsense probably null
IGL00780:Clpb APN 7 101778608 nonsense probably null
IGL00951:Clpb APN 7 101751260 missense probably benign 0.00
IGL01374:Clpb APN 7 101773128 missense probably damaging 1.00
IGL01542:Clpb APN 7 101787505 missense probably damaging 0.98
IGL02203:Clpb APN 7 101779337 missense probably damaging 1.00
IGL02989:Clpb APN 7 101779220 missense probably damaging 1.00
IGL03088:Clpb APN 7 101785449 nonsense probably null
Surfeit UTSW 7 101711465 missense probably damaging 1.00
PIT1430001:Clpb UTSW 7 101786719 missense possibly damaging 0.95
PIT4486001:Clpb UTSW 7 101663932 missense probably benign 0.17
R0611:Clpb UTSW 7 101787749 missense possibly damaging 0.71
R1565:Clpb UTSW 7 101785461 missense probably benign 0.00
R1760:Clpb UTSW 7 101786698 missense possibly damaging 0.92
R1879:Clpb UTSW 7 101706483 missense probably benign 0.23
R1933:Clpb UTSW 7 101779211 missense probably damaging 0.96
R1938:Clpb UTSW 7 101763656 missense probably damaging 1.00
R2922:Clpb UTSW 7 101722828 missense probably benign 0.02
R2923:Clpb UTSW 7 101722828 missense probably benign 0.02
R2995:Clpb UTSW 7 101779324 missense probably damaging 1.00
R4492:Clpb UTSW 7 101787722 missense probably damaging 1.00
R5384:Clpb UTSW 7 101779341 missense probably damaging 1.00
R5973:Clpb UTSW 7 101663997 missense probably benign 0.02
R6787:Clpb UTSW 7 101663659 unclassified probably benign
R7158:Clpb UTSW 7 101663832 missense probably benign 0.45
R7225:Clpb UTSW 7 101711465 missense probably damaging 1.00
R7239:Clpb UTSW 7 101711455 missense probably damaging 0.96
R7482:Clpb UTSW 7 101786719 missense possibly damaging 0.95
R7499:Clpb UTSW 7 101722728 missense possibly damaging 0.92
R7547:Clpb UTSW 7 101664296 intron probably null
Predicted Primers PCR Primer
(F):5'- AACTTAAAATGTTGAAGAGCTAAGCA -3'
(R):5'- ATGGTGCCAGAAGAGTGGT -3'

Sequencing Primer
(F):5'- CAAGGCTAGCGTGGTCTACATG -3'
(R):5'- AGAAGAGTGGTGGCCTCTC -3'
Posted On2019-11-26