Incidental Mutation 'R7769:Adam26b'
ID598474
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7769 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43521695 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 90 (R90L)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably benign
Transcript: ENSMUST00000080135
AA Change: R90L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: R90L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Abhd14b T C 9: 106,451,620 Y147H probably damaging Het
Agt A T 8: 124,564,550 M6K probably benign Het
Akr1c14 T C 13: 4,059,644 S5P probably benign Het
Arhgef38 A C 3: 133,149,622 S235A unknown Het
Cabp5 A G 7: 13,400,733 D31G probably benign Het
Cacna1h T A 17: 25,385,805 D1178V probably damaging Het
Ccdc88a A T 11: 29,482,381 E1199D probably damaging Het
Cd244 A T 1: 171,577,305 I242F probably benign Het
Clpb G T 7: 101,722,717 R220L probably damaging Het
Cltc C T 11: 86,719,493 R638H probably damaging Het
Cnr1 A T 4: 33,944,892 M427L probably benign Het
Ctnnbl1 C T 2: 157,737,470 probably benign Het
Epb41l2 A T 10: 25,493,573 T597S probably benign Het
Epb41l3 T C 17: 69,238,426 Y163H probably damaging Het
Fam129b A G 2: 32,919,832 T314A possibly damaging Het
Fgg A G 3: 83,013,126 probably null Het
Gm37240 A T 3: 84,509,925 D162E possibly damaging Het
Gm44511 T A 6: 128,820,277 T83S probably benign Het
Gm6685 T A 11: 28,339,252 Y188F probably benign Het
Gprin2 A T 14: 34,195,613 C67S probably benign Het
Grk6 A G 13: 55,451,007 D140G probably benign Het
Hps3 T C 3: 20,018,808 probably null Het
Hspb7 T C 4: 141,424,024 V159A possibly damaging Het
Ibsp A G 5: 104,310,184 N196D probably damaging Het
Ibsp A G 5: 104,306,005 N70D probably benign Het
Igfn1 A T 1: 135,982,405 F147Y possibly damaging Het
Iqca T G 1: 90,077,810 D492A possibly damaging Het
Klhl42 T C 6: 147,091,860 L110P possibly damaging Het
Krt12 C T 11: 99,418,026 R395Q probably damaging Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Mttp A C 3: 138,103,112 L730R probably damaging Het
Muc16 T A 9: 18,660,507 I239L unknown Het
Myo15 T C 11: 60,509,149 F1723L Het
Nin T C 12: 70,043,230 D1137G Het
Nsf C T 11: 103,928,839 V35M probably damaging Het
Numa1 T A 7: 101,999,000 I646K possibly damaging Het
Nwd2 A G 5: 63,804,504 N477S probably damaging Het
Olfr59 T A 11: 74,288,763 V39E probably damaging Het
P4ha3 A G 7: 100,285,717 D62G probably damaging Het
Palb2 G T 7: 122,128,415 D77E probably benign Het
Pcmtd2 T C 2: 181,851,701 V233A probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr C T 9: 8,946,855 T699I possibly damaging Het
Pknox2 C A 9: 36,895,306 probably null Het
Ppp2r3d T C 9: 124,439,087 H110R Het
Psmd11 T A 11: 80,434,582 probably benign Het
Pyroxd2 T C 19: 42,747,562 N59S probably benign Het
Qser1 A T 2: 104,758,576 D1662E possibly damaging Het
Rasip1 A G 7: 45,628,815 Y180C probably damaging Het
Rbl1 T C 2: 157,191,980 S393G probably benign Het
Rtn4r C T 16: 18,151,289 P194S probably benign Het
Ryr1 C T 7: 29,098,785 G944D probably damaging Het
Scamp3 A G 3: 89,177,991 D23G probably damaging Het
Secisbp2l CTGGG C 2: 125,771,545 probably benign Het
Shcbp1 A G 8: 4,739,232 I529T probably damaging Het
Slc5a10 T A 11: 61,673,647 D502V probably damaging Het
Smad5 T C 13: 56,733,042 I323T possibly damaging Het
Spred1 T C 2: 117,177,449 S279P probably benign Het
Stag1 T A 9: 100,944,827 V949D possibly damaging Het
Stxbp3 A G 3: 108,800,828 S386P probably benign Het
Syt14 A G 1: 192,984,324 S91P unknown Het
Thpo C T 16: 20,725,651 A211T probably benign Het
Tns1 T A 1: 73,953,371 D716V probably damaging Het
Trbv26 A G 6: 41,227,547 Y8C probably benign Het
Tshr A G 12: 91,538,270 I661V probably damaging Het
Uvrag G A 7: 98,979,721 P380S probably damaging Het
Vkorc1 G T 7: 127,894,524 Y88* probably null Het
Vmn1r63 C T 7: 5,803,370 V88M probably damaging Het
Wdsub1 A G 2: 59,878,419 Y37H probably damaging Het
Zap70 A G 1: 36,770,902 D31G probably benign Het
Zc3h12d G A 10: 7,867,626 A387T probably benign Het
Zfp438 C T 18: 5,213,377 R527H possibly damaging Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7596:Adam26b UTSW 8 43520200 missense probably benign
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7918:Adam26b UTSW 8 43521101 missense probably benign 0.14
R8286:Adam26b UTSW 8 43519961 missense probably benign 0.05
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCAGATGTTCAAATGTTGACG -3'
(R):5'- TCTCTGCATGGTCACCAATTGG -3'

Sequencing Primer
(F):5'- TCAAATGTTGACGTTGAGCTC -3'
(R):5'- GGCATGCTAAGTACAGTAGCCTTC -3'
Posted On2019-11-26