Incidental Mutation 'R7770:Slc9a4'
ID598504
Institutional Source Beutler Lab
Gene Symbol Slc9a4
Ensembl Gene ENSMUSG00000026065
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 4
SynonymsD730009J23Rik, NHE4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7770 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location40580081-40630725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40600963 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 305 (I305T)
Ref Sequence ENSEMBL: ENSMUSP00000027233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027233]
Predicted Effect probably damaging
Transcript: ENSMUST00000027233
AA Change: I305T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027233
Gene: ENSMUSG00000026065
AA Change: I305T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 73 477 1.6e-90 PFAM
PDB:2E30|B 481 516 9e-8 PDB
Pfam:NEXCaM_BD 566 675 8.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display normal growth and survival but have gastric secretions with reduced acidity, mild gastric necrosis and apoptosis, and abnormal gastric mucosa with reduced numbers of parietal and chief cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Slc9a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc9a4 APN 1 40629405 missense probably benign 0.01
IGL01802:Slc9a4 APN 1 40607798 missense probably damaging 1.00
IGL01909:Slc9a4 APN 1 40612291 splice site probably benign
IGL02137:Slc9a4 APN 1 40600899 missense possibly damaging 0.79
IGL02399:Slc9a4 APN 1 40600782 missense probably benign 0.00
IGL02685:Slc9a4 APN 1 40629582 missense probably benign
IGL02874:Slc9a4 APN 1 40584038 missense probably benign 0.02
IGL02892:Slc9a4 APN 1 40584044 missense possibly damaging 0.64
IGL03028:Slc9a4 APN 1 40610377 missense probably benign 0.06
IGL03083:Slc9a4 APN 1 40629402 missense probably benign 0.00
IGL03124:Slc9a4 APN 1 40580735 missense probably damaging 0.99
IGL03144:Slc9a4 APN 1 40612202 missense probably damaging 1.00
IGL03286:Slc9a4 APN 1 40580768 missense probably null 0.99
R0601:Slc9a4 UTSW 1 40603070 missense probably damaging 1.00
R1118:Slc9a4 UTSW 1 40584330 splice site probably benign
R1583:Slc9a4 UTSW 1 40600962 missense probably benign 0.01
R1752:Slc9a4 UTSW 1 40629261 missense probably benign 0.00
R1776:Slc9a4 UTSW 1 40629287 missense probably benign 0.00
R1785:Slc9a4 UTSW 1 40607741 splice site probably null
R1786:Slc9a4 UTSW 1 40607741 splice site probably null
R2131:Slc9a4 UTSW 1 40607741 splice site probably null
R2132:Slc9a4 UTSW 1 40607741 splice site probably null
R2133:Slc9a4 UTSW 1 40607741 splice site probably null
R3785:Slc9a4 UTSW 1 40583970 missense probably damaging 1.00
R4223:Slc9a4 UTSW 1 40619126 missense probably damaging 0.98
R4567:Slc9a4 UTSW 1 40580577 missense probably damaging 0.99
R4605:Slc9a4 UTSW 1 40601035 splice site probably null
R4641:Slc9a4 UTSW 1 40607125 missense probably damaging 1.00
R5407:Slc9a4 UTSW 1 40607794 missense probably benign 0.41
R5823:Slc9a4 UTSW 1 40619117 missense probably damaging 0.97
R5877:Slc9a4 UTSW 1 40612263 missense probably benign
R6389:Slc9a4 UTSW 1 40580684 missense probably benign 0.00
R6430:Slc9a4 UTSW 1 40600854 nonsense probably null
R6603:Slc9a4 UTSW 1 40623504 missense probably benign 0.43
R6950:Slc9a4 UTSW 1 40602885 missense probably damaging 1.00
R7102:Slc9a4 UTSW 1 40580639 missense probably benign 0.00
R7102:Slc9a4 UTSW 1 40623399 missense probably damaging 1.00
R7230:Slc9a4 UTSW 1 40600771 missense probably damaging 1.00
R7313:Slc9a4 UTSW 1 40629503 missense probably benign 0.28
R7384:Slc9a4 UTSW 1 40612251 missense probably benign 0.10
R7405:Slc9a4 UTSW 1 40600926 missense probably damaging 1.00
R7784:Slc9a4 UTSW 1 40600776 missense probably damaging 1.00
X0060:Slc9a4 UTSW 1 40619031 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTACTTCTCCAGGTCTTATACAAC -3'
(R):5'- GGACCAGGTTCAGCTTTCAG -3'

Sequencing Primer
(F):5'- CATACTAATTGCCTTCACTAAGATGC -3'
(R):5'- CCAGGTTCAGCTTTCAGAAAGTTAAG -3'
Posted On2019-11-26