Incidental Mutation 'R7770:Dnpep'
ID598505
Institutional Source Beutler Lab
Gene Symbol Dnpep
Ensembl Gene ENSMUSG00000026209
Gene Nameaspartyl aminopeptidase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7770 (G1)
Quality Score179.009
Status Not validated
Chromosome1
Chromosomal Location75307896-75317990 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 75317246 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066668] [ENSMUST00000113605] [ENSMUST00000185419] [ENSMUST00000185797] [ENSMUST00000187000] [ENSMUST00000187075] [ENSMUST00000187836] [ENSMUST00000188652] [ENSMUST00000189282] [ENSMUST00000189551] [ENSMUST00000191254]
Predicted Effect probably benign
Transcript: ENSMUST00000066668
SMART Domains Protein: ENSMUSP00000070821
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 2.9e-199 PFAM
Pfam:Peptidase_M42 328 455 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113605
SMART Domains Protein: ENSMUSP00000109235
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185419
SMART Domains Protein: ENSMUSP00000140035
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 459 7.3e-192 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185797
SMART Domains Protein: ENSMUSP00000140864
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 462 2e-190 PFAM
Pfam:Peptidase_M42 330 457 1.9e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187000
SMART Domains Protein: ENSMUSP00000141014
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 271 2.9e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187075
SMART Domains Protein: ENSMUSP00000140877
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 222 1.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187836
SMART Domains Protein: ENSMUSP00000139739
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188652
SMART Domains Protein: ENSMUSP00000139532
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 85 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189282
SMART Domains Protein: ENSMUSP00000141187
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 57 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189551
SMART Domains Protein: ENSMUSP00000140563
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 198 6.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191254
SMART Domains Protein: ENSMUSP00000140997
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 64 8.8e-11 PFAM
Pfam:Peptidase_M18 60 92 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Dnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Dnpep APN 1 75315688 missense probably damaging 1.00
P0026:Dnpep UTSW 1 75308685 missense probably benign 0.01
R0126:Dnpep UTSW 1 75312538 nonsense probably null
R0318:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R0669:Dnpep UTSW 1 75311778 unclassified probably benign
R1076:Dnpep UTSW 1 75315938 unclassified probably benign
R1478:Dnpep UTSW 1 75316027 missense probably damaging 1.00
R1803:Dnpep UTSW 1 75309414 nonsense probably null
R3409:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R3411:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R4590:Dnpep UTSW 1 75316401 missense probably damaging 1.00
R4863:Dnpep UTSW 1 75309230 intron probably benign
R4948:Dnpep UTSW 1 75316760 missense probably benign 0.13
R5873:Dnpep UTSW 1 75315143 missense probably damaging 1.00
R5891:Dnpep UTSW 1 75311812 missense probably benign
R5907:Dnpep UTSW 1 75311991 critical splice donor site probably null
R6143:Dnpep UTSW 1 75315228 missense probably damaging 1.00
R6432:Dnpep UTSW 1 75315378 missense probably benign 0.12
R6433:Dnpep UTSW 1 75315378 missense probably benign 0.12
R7188:Dnpep UTSW 1 75316057 missense probably damaging 1.00
R7189:Dnpep UTSW 1 75313430 missense probably damaging 1.00
R7620:Dnpep UTSW 1 75313448 missense probably benign 0.02
R7682:Dnpep UTSW 1 75316740 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCAAAGCTGGAAAGGC -3'
(R):5'- TCAGCGTGTTTGGAACCAGG -3'

Sequencing Primer
(F):5'- CTCAAAGCTGGAAAGGCCACTAG -3'
(R):5'- TGTTTGGAACCAGGCCTGAC -3'
Posted On2019-11-26