Incidental Mutation 'R7770:Zc3h15'
ID598509
Institutional Source Beutler Lab
Gene Symbol Zc3h15
Ensembl Gene ENSMUSG00000027091
Gene Namezinc finger CCCH-type containing 15
Synonyms2610312B22Rik, FM22, Ierepo4, 1700006A17Rik, 1810012H02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R7770 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location83644435-83664622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83658132 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 138 (I138N)
Ref Sequence ENSEMBL: ENSMUSP00000080301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081591
AA Change: I138N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080301
Gene: ENSMUSG00000027091
AA Change: I138N

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
coiled coil region 60 86 N/A INTRINSIC
ZnF_C3H1 99 125 7.84e-8 SMART
ZnF_C3H1 175 211 3.81e0 SMART
Pfam:DFRP_C 229 336 4.2e-23 PFAM
low complexity region 410 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Other mutations in Zc3h15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Zc3h15 APN 2 83660173 missense probably damaging 1.00
IGL01688:Zc3h15 APN 2 83662192 missense probably damaging 0.99
IGL01951:Zc3h15 APN 2 83661485 missense probably damaging 1.00
IGL02514:Zc3h15 APN 2 83653381 missense probably damaging 1.00
IGL02852:Zc3h15 APN 2 83644671 missense possibly damaging 0.85
IGL03075:Zc3h15 APN 2 83662191 missense possibly damaging 0.95
IGL03055:Zc3h15 UTSW 2 83661171 missense possibly damaging 0.90
R0117:Zc3h15 UTSW 2 83658083 missense possibly damaging 0.51
R0465:Zc3h15 UTSW 2 83663815 splice site probably benign
R1711:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R1861:Zc3h15 UTSW 2 83663990 missense unknown
R2258:Zc3h15 UTSW 2 83657016 missense probably benign 0.00
R2325:Zc3h15 UTSW 2 83653439 missense probably damaging 1.00
R4152:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4154:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4420:Zc3h15 UTSW 2 83658012 missense probably damaging 0.97
R5384:Zc3h15 UTSW 2 83660230 missense possibly damaging 0.55
R6341:Zc3h15 UTSW 2 83661223 missense probably benign 0.11
R6544:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R6923:Zc3h15 UTSW 2 83657056 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTTGAACACGGGTTACCTGC -3'
(R):5'- ATCAATCCAAGCTCCCAGGG -3'

Sequencing Primer
(F):5'- CAGATCCCAAATCTGTGG -3'
(R):5'- CTCCCAGGGCAGCTTATATAAATAAG -3'
Posted On2019-11-26