Incidental Mutation 'R7770:Dnajc5b'
ID598514
Institutional Source Beutler Lab
Gene Symbol Dnajc5b
Ensembl Gene ENSMUSG00000027606
Gene NameDnaJ heat shock protein family (Hsp40) member C5 beta
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7770 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location19508595-19610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19579017 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 135 (C135S)
Ref Sequence ENSEMBL: ENSMUSP00000029132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029132] [ENSMUST00000118735] [ENSMUST00000118968] [ENSMUST00000165693]
Predicted Effect probably benign
Transcript: ENSMUST00000029132
AA Change: C135S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029132
Gene: ENSMUSG00000027606
AA Change: C135S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118735
AA Change: C135S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113414
Gene: ENSMUSG00000027606
AA Change: C135S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118968
AA Change: C135S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112849
Gene: ENSMUSG00000027606
AA Change: C135S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165693
AA Change: C135S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127515
Gene: ENSMUSG00000027606
AA Change: C135S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of co-chaperone proteins that is characterized by an N-terminal DNAJ domain, a linker region, and a cysteine-rich C-terminal domain. The encoded protein, together with heat shock protein 70, is thought to regulate the proper folding of other proteins. The orthologous mouse protein is membrane-associated and is targeted to the trans-golgi network. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Dnajc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1630:Dnajc5b UTSW 3 19574741 missense probably damaging 1.00
R1714:Dnajc5b UTSW 3 19579101 nonsense probably null
R3011:Dnajc5b UTSW 3 19546802 missense probably damaging 1.00
R3859:Dnajc5b UTSW 3 19574802 nonsense probably null
R5268:Dnajc5b UTSW 3 19579060 missense probably benign 0.00
R5281:Dnajc5b UTSW 3 19610560 missense probably benign 0.37
R5337:Dnajc5b UTSW 3 19574782 missense probably damaging 1.00
R5929:Dnajc5b UTSW 3 19546855 missense probably damaging 1.00
R7081:Dnajc5b UTSW 3 19546861 critical splice donor site probably null
R7782:Dnajc5b UTSW 3 19574842 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGGATGTTGGGTATCATTAATCC -3'
(R):5'- CTGCCCACAAAAGCTGGTAG -3'

Sequencing Primer
(F):5'- ATCCTATGAGGTATACACTTACAGAC -3'
(R):5'- CCCACAAAAGCTGGTAGTCTGG -3'
Posted On2019-11-26